Description :
From Genome Similarity Track
Location :
Scaffold_78:86198- 87640
Transcript NameFunction/comments
g9139.t1OWZ13430.1 M96 mating-specific protein [Phytophthora megakarya

Sequence
1442 bases(100 bases per row)
TTTGGTGTACTTGGAGTTCCGATGCTGGTTATACTCCTTGTCTGTCTAGCATGGACATCGTGGCTGATTTTCTTGGCTCTTGCACCAAACAAAGCAGCGA
ATATGCTCATGGACACGAGTTCGTACGACAATGGACAGTTCTGGTTATTTAACGATGCTCATCCGCAAATGGTTCTTGCTGGAGCTATGGGGTTGGCTAT
TGTGGACACTTGTTACTTGGTCGTGACGTTGCGGATGTTGCTATGGCGCGATAAGTTGTTCGGCTCAGCTTATCATACCAGTCGTTCAACGACTAGTGTC
ACAGGCCCGCACTCCTGGATGAGGAATAGACGACCAACATATAAACGTCTCCGACTTGTTTGGGAGGAGCTTACAGCTTTCGAGGGACGAAATCGCAAAA
AATGGGTAGGCGTCATGTGTTGAATTTTACTTCAATTACTGTAGTACTTGTTAACAGCATTATTTTGCAGAATGCATTTCTCAAGCTAATAGACCTGGCC
ATGGAGACAGCGCTACTTCGTCAGCTTCTGCAAAGTGGAAGCCCCGTCAGCCTCACCTATGGTTTTGCTACTTTCTTGGCAGTGAACGCGTTGTCGTGCG
TCGTGAACGTGCTCACCGACCGATTTTCAGCGCTGACAGAAGTTTTCATCGACTCTGTGTACGTTTTCTGTTGGAAAAAACGATGAACGCCGTAGTACTG
AATTCTCTGTGTACCTCTCAGTTTCGACTTGTCGGCAGCAGTGTTGTTCCCGATCACAACGCTTGTCTACTGCTACTATAATTTCGACTTTGATCGAGAA
GTTTATCTCACATACCTGGAGAAACTCCCGGCTGGCAGCTTCGAACATCTCGCTCGGTCATTTGCAGACCAGTCAGAAATTGCTCTCTTTCGTGTAAATT
TCGACTCGCTCCGCATCGACTCACTCGTGGATTTTGGGTTACGCATCAGTATGAATCTGACGTTTTGTTATCGCTTCGAGCGTTTACTTCAGGCAATTGT
TTGGACACGGCATCGCGAATTGATTGTGAAGAGGCTTATTACACCGACAAATGCTACGCAGAATCCAGTTCCCAAAGCGATCACGGCCGTGTTCGTTGCA
GTGAGCTTGGTAGTGTTACTATCAACTCACAAAGCTGTCGCAGATTCAACCGCGTTGTGTTCTTCACATCCGGAATGTGTTGTGTATGCACACCAGTGGG
AAACCAGCGATACTTATTGTCCATGCCTCATTCTTATCGATGTCAATCTCACACCCAAGACTTATGAGGAATGGATACATCCTATCGACGCATACGACAA
AGTGAAAGCTCTCGCTGGTGCCGGGATGCTCAGGTCCCTTCAAGTGATCAACCGCCAGCTTTTAGAATGGCCGGAAGAGCTTCGAAAGTGCCGTGATATC
AGAGTCATGTGCGTTATGTTAGCCATAGCAACTCCGATCTCT