Description :
From Genome Similarity Track
Location :
Scaffold_1108:8617- 13907
Transcript NameFunction/comments
Phypl_g12406hypothetical protein

Sequence
5290 bases(100 bases per row)
tctttttcttctcgtAACTTCAGCGTTCCTCCAAACAAAATAACAAATGCAAAAACAAACTTTcaccttcctcctccgttccgttcttgagctccaatTC
CAAATACATAACCACAAACCGTTCTCTCGATCTCAAGGACGTGACATCCGGGCCTAAGccaccagcaggtcgtcgtcctctacGCGGGCATTGGCATCCG
CCAACCGCGCACTTCTCCGTAGTTTCGGGAGACGACGTTTCTTCCTTTCAGCCTGCTCGAAGGCCATCACCAAGGCAGCATACTCGGGCATCAACTCAGC
CCGTGACAACCAGAAACTCTCATAATTCGCAGCCAACGCCAAGTACTCCACTGTCCCTTGGACGACTCGCTTAGCCACGACTTCCAACAACGGGGAATCC
ACGCCTGCAATAACCGTGTCTTCTTGACCAAGCGTCAGTCGCTCCGCATAGCTAGACGCAGGCAGGTCGGACTCTCCCAGTGGTCCCCCATCCACCTCAT
TACCCTCAAGACCTTCCGGTACCTCATCATGGTACGGCCTAGTCCACTTCCCtctgaagcgcttgagccgATTCACGTTGATCATCACTACTTTACTCGG
GTGCGAGGGTATGTCGACTTGGTACGCGTTCTCCCCGACTTTGCTCACAACACGGTACGGACCGTGCCAGGAgaacgcgagcttcttcgttCGTACCTGC
CCTAAACAGCTGATACACCGACACGGGATCGCCGACTTCATACTCGACATGCATTTGATCCAGCAACCGTCGCTCGTGACGGTCTTGAGCTTTCACCAAC
TGTCGTTTGACCAAGTGACGGGACTCCCTAAATGAACGGTACAGGTTCCGTCTGTactgcaccacctcgttgctcttccacttcttccCAAGGTTCAGGA
AGGCAACGTCCACAGGGAGCGCAGGATCGCGACCATACAGCGAAAAGAACGGCGTGTCCCCAAGGCTTCGTTATAGGCCGTCCTGTACGCGAAGAGCACT
CTCGGCAAATACAGGTCCCAGTCCGTCTGAGCCTCGCTCACATGCATCATCAGCATCCCAATGAGCGTCCCATTGAACCGTTCCGCTAACCCTTGCGTCT
AAGGATGGTAAGCGGTACCGAATAGCTTCTTGATGCCTAACGTCTGGTAGCTTCTTGATGCCTAACGTCTGGTAGAACGACTTGGCAATTTCGGACGAAA
AGTTCGAGCCATTTTCGCTCGATAGGCGAGAGGGTACACCATGTCTAGCCACGACAACGTTAACCATGACTTCAACAAACGTCACAGAGTCCAACCGTTC
GACGGCAAACTCTTCGACCCACCGTGTAAAGTCGTCTGCGAACACGAGGATGTACATGTTCCCTCGCTCGGTCTCAGGCAACGGTCCGATCGCGTCGACA
ACCAGCAACGAAAAGGGCCCCGTTAGGTCGGCCACAGGCATCCGTTGCATCTGACCAGCTCTCCACGGTCGTGGGCCTTTCCCACTACCGCACAGGTTGC
ACTCACGCAGATACTCAGCGACGTCCTTCCGCCATCCAGGCCAGAACGCATGACGCCTCACCGTCTCCAAAGTCTTCGTTAAACCCAAATGCGACGAGAA
AACGTCCGCGTGGCAGTAGTGAAGCATGGTCTCGACGTAAGGCAACGGTACAACCGGATCGGTTAGCGACCGTGCCGGACCAACTCTAGTAGGCAAATCA
ACACGCCTCAAGAGTAGACCGTTCGCCACTTCGTATCGAGACGCCATTCCCACTACACGAGCTCTCAGGGACGGATCCAGCGGCAACGCTCCGTCTAGTA
GGAACGCTCCGAGCGCCTTCACCCACGgcaccttctgctgctcgtccacgaactgcttGAGGTCCAACCCGAATCGATCCACGGACTCCTACTCGGCGTT
CGAGGgggcctcgtccacggctTCTCCCTGCGTGGGTTCCGTCTCGGGATCATCCACGTGACCatcgccttcctcctcgaagtcttcatcttcgtaGTCG
AGCTCGTGCACACCCGTGTCGGACCGAACCGGCTCCCCGACCGAAGCTGGACCCACGTCCTGCTCAGCAATCTTAGGGTTGAGCAGATCAGCCATAGTCA
ACGCATCCACTCGGTCGGCTGGCAACCACGACAGCCCGTCAACGTGCCCCATACTAGCCCCAGGCTTATGGTGCACCTTGAACTGCAAATTCGAGGCTCC
ATGGCCCACCGTGCCAACTTGGCGTTCGTAGTACGGTTCCCAGGGCTGAACACCCACGTCAACGCTTGATGATCCGTATACAGGTCGAACTCCCGCTGGT
CCAGGTATCAACGGAACTTTTGCGTCGCCCACACGACACCCCAGCACTCGATCTCCGAGATGCCATCCTGCTTGTTGATCCAATTCTTCTGTGAACCGGT
AAGAAACTTGCTGGCGTAGGCCACGACCCGATTCCGACCGTCGACGTCTTGGATAAGACACGCTCCGACCGCATAGCGAGAGGAATCAACGAACGCTTTG
AACCGTCTCTTGCCGTTCAGATAGACCAGTATCGGCGGCTTCACCAGGGCACGCTTGAGCTGACGGAACGCTGCTTCGCAGTCTTCCGTCCACGAAAACG
GAGCGTCCTTCACCTTCAACCGTTCCAGAGGCGCCGAAATCAAGGCGTACCCCGGGATATACCGTCTGAAATAGCTAGTAAGTCCCAAGAAAGACCGAAT
TCCATGCAGGTCCTTTGGTCGCTGCACGTTCATGACCGCTTTCACCTTCTCCGGGTTGGGCAGGATCCCCGAGGGCGTCACAATGTGCCCCAGGAAAGCA
ACCTGGCTCCGTCCCCAATGACACTATTTCATCTTCAGCTTAAAGCCGCCTTGTCAACACTTGACACACTCGCACAAAATGAGACGGACGGTCCTTGCTA
AAGATGACACATTCATCCAGATACACCAAACAGATTCGCCACTTCAGATCGACGAGCACCGTCTCCATTAGACGCTCGAACGCCGGCACTGCGTTGCAGA
GTCCAAAGGGCATCACTAATCACTCGTAGAGACCGTATTTACACGTAAACGCCGTCCTGATCACACTGTCCTCGTGCATCGGGACGTTCTAGTACCCGGA
CGCAATGTCCATGGTCGAGGACAGCTGATCATCCCCTAAGACGTCCAGGATGTCATCAATCAAGATCATAGGATAGCAGTCTTTCACGGTCACAGCGTTC
AGCTTCCGGTAGTCGATGCAGAACCGAATCCCCCCGTCAGGCTTCAGGATCGTGACCACCGGGCTAGCCCACGGATTGTTCGAGGGACGTATGAACCCTA
AGCCCAGGTACTGGTCGATCTCTGCCTCCATTACTTCGCCTTCCGCAAGCGATACGCGGTGCAGTTGCGACTTAACCGGCGGGCTGTCGCAAGTGTCAAT
CTTGGAGTGTAGCAACTCCGTCCGTCCAGGTCTCTTCGACGACCCCACAAACATGTTATCGAACTGGTCTAGCACTCTCTGGAACAAagccttctgctcc
accgACAGATCCGAGTCCGAAACGTCCGCTTCCGAGCCGTCCTCCTTGTCAGGGGGGAGGTCGGGCTTGGACGCTTCCACTCGTTCTTCAGTGCCCTCAT
CGCGCTCCTCAGCGACGGACATCGCACCGTCAGGCTCCGTACCCTCGCTAGGAACTTCGCTCTCAGCCGACCCTTCGGCACTCGTCGACTGTTTGAAGCC
GAACGCAGACTCGGGAATCACGGATGTAGAGGCTACAACCGTACCCTTCCGAATCCTGCACTCCTCGGTCGACGCATTGCACAGTTCGACCAGGGCCTTG
CCATCCGTAACCGTTCCTAACGAACGCGCCACGCACAGCGTAGGCGGCAGTCCTAGCGATCCTTCCACTAGAACCGTAGCTTCCTCCGCAATGTCACCAA
TGACATTGGCGACCACTACCGCTTGACCTTGAGGGGGCAGTCGCACCGAGCTCGACATCGTGGCCATGAACGTCTCTTGAACCACCGTGACGCCGAGATC
CAACACATCGCCAGTCCTCTTGAGCGTCATCTTTCGCTCCGCCACATCAATGACGGCTCCAAAAGCTCCAAGAGCGTCAACACCTAGGATAGTGTCTACG
TGCAAGCGGTCGGATACGAGTAGATGCATAGACACTTCCAGCGTCCCCACCCGTATAGGCCGACGTATCCAACCCCGAATACGCAGCCGATGTCCCGACG
AACTCCTCACACGACCTTCGTACGGTTCCAGCGGCTCGGTAGCTCGACTCAGGCGCTTCAACACCTGCCGATCTACCAAACTCAGCGTAGCTTTAGTATC
AACTAGCATTTGGGATGCGAGACAGTCAGTGTAGCCCCCAGAGAAAGCCTCGAAGTTCCCCACCGCACAGACTACGTGCCGACCGCCTTCACCAAAGCGA
GGCACCTCAacgtcgccctcgtcgtcacACACTCCGAAACCGTTCGGCAGATTGACCGTGACGACCTCAATAAGCCCCGGACGCTCCGTCCATTTTGGGT
CAAACCGTTCTGGACCACCAAACTGAACATAGTTTGAtgcgtcgtcttcacgcTCCGGCCGCAACTCAAAATCACCCAGAGCTTCTGCGCAGCCCCGGTA
CAGCGATGAACAATCAAAACCCACTACTTTCCacgctcgtcgacggcgtcgacgtctcgCACTCGGCGTCCTTGACCCACTTGTCCGATCACACAGCTTT
CTCCAAATCAGAGCCGCGTTTTCAGCGTAGTAGTCCTCCACCCAGTCTACTAGACTATCCCAAAAGTGACCGAGGAGAGCACCAGCCTCCACTTCCTTGT
CGGCATGCCACTGAATCCGCTCCCAATCCAGCTCGGGCACCTTGTCTCGCAGCGGGGGAATATCAATCGTCCCCGTGCCGTCTTCAGGCAAAGAACTCGG
ACCGTGGGCAGCGTGAGCGCccgtcttggcctccttcagcatTCGGAACACCGCCAACAGAGCTAGGGTCCTCACCTTCGCGGCCTGCATCTCCGCTGAG
CCCACTAGCTCCGAACTCACAGCATCTCCCTCCAGCGAAGCGACGACTCCTTCATCTACTCCAACCGTACATACTAGATTCTCAGCAACCGTTTCCTCGA
GCATCAAACTGTCCTTAGGCGCACCGGCCTTAGACTCGTTCTCATCCGTGCCAGACGCGGCGGACACCCAACTTGGCTTGACGACGGCCTCTGCTGAGTC
AATCACACTGGACACAGTCTTGCGGAAGTCGCGGCTCGCTCTCTTAGCTTCCGCCGAATTCTCCAACGTTTCACGGAACCACTCTTGCCA