Description :
From Genome Similarity Track
Location :
Scaffold_289:8617- 9639
Transcript NameFunction/comments
Phyke_g7854DEAD/DEAH box RNA helicase, putative

Sequence
1022 bases(100 bases per row)
AACTTGGAGCTGTGCAAGTACAGCAAGCCCACCCCCGTGCAGAAATACTCGATCCCCATCGGTCTGCAGGGTCGTGATATGATGGCTTGTGCCCAGACGG
GTTCCGGTAAGACGGGTGGGTTCCTGTTCCCCACTCTGGCGGCTATGCTGCGTGTTGGCGGCACCCCGCCCCCGGATGTCGGTCACGGCCGCTCGCGGAA
GATTTTCCCGGCTGCCTTGATTTTGGCGCCGACGCGTGAGTTGGCGTCGCAGATTTACGATGAAGCCAAGAAGTTTTGCTACTGCACGGGTATTGCCCCT
GTGGTTATCTACGGTGGCGCCGAGGTCGGCCGCCAGCTGCGTGAGCTCGAGCGTGGTTGCGATATGCTGGTGGCCACCCCTGGTCGTCTTGTGGACCTGA
TGGAGCGTGGACGTATTTCGCTGTCGTGCATCCGTTTCCTGATTCTGGATGAGGCTGATCGTATGCTGGATATGGGTTTTGAGCCGCAGATCCGTCGCAT
TGTCGAGCAGGAGGACATGCCCCGTGAGCGTCAGACGTTCATGTTTAGTGCTACGTTCCCGCGCGAGATTCAGCGATTGGCTTCCGACTTCCTGCGCGAC
TACATTTTCTTGACGGTTGGCCGTGTGGGTTCGGCGTCAAAGGATGTCAAGCAGACTGTGGAATACATTGAGCAGTACGACAAGGAGGACTACCTGGTGC
GTTTCCTCAACCAGGTGCAGGACGGTCTGATTCTGGTGTTCGTGGAGACGAAACGTGGTGCCGATTTCCTGGAGGACATGTTGTGCCGCGAGGGTTTCCC
GGCCACGTCAATTCACGGCGATCGCTCGCAGCGCGAGCGTGAGGCCGCTCTGGCTAGCTTTAAGTCGGGCCGTACGCCCGTGCTTGTGGCAACGGACGTT
GCTGCCCGTGGTCTTGATATCGATGGTGTGACTCAGGTGATCAACTTCGACCTGCCCAACAACATTGATGACTACGTGCACCGTATCGGTCGTACCGGCC
GTGTGGGTAACATTGGTTACGC