Description :
From Genome Similarity Track
Location :
Scaffold_53:86169- 93717
Transcript NameFunction/comments
Phymu_g2844conserved hypothetical protein
Phymu_g2845hypothetical protein PHYSODRAFT_506356
Phymu_g2846conserved hypothetical protein
Phymu_g2847conserved hypothetical protein
Phymu_g2848hypothetical protein

Sequence
7548 bases(100 bases per row)
GGTATCTACGATAATGGAAGTGGTTGTGCTCGGCTGCGGCCCCTCCTCGTCGGTGCCGTCCATGCGCTGCGTGCTGAGCAAGGAGTGCGCCGTGTGCCAC
GAAGCGCACGCGAATCCGGACTCCAAGAACCGTCGACTCAATCCAAGTCTGCTCGTGCGGAACCtcaaggaggacaagaacgTCCTTATCGACTGCGGCA
AGACCTTCCGCGAGGCAGCTCTTCGAATCTTCCCCAAGATCGGCGTGTCGGCGGTTCATTCACTAGTGTTGACGCACGACCACGCGGATGCGATGCTGGG
GATGGACGACCTGCGGGAGGTGCAGGCTACCGTGGAGACTGTGGATCCAGTGACcaaggagctgtacaagaTCCCGCCGGAGGCCATGAAGGTGCACTGC
AGTGAGCCGACAAGCCACGGTGTGGTCGCTAAGTTCCCGTACTTGATCGACAATGaacctcttcctccagtGGGGGAAGGAGTCCCGAAACCATTCCGAT
GGACTGCCAAGCTTCAAATTGAGAACTTTGGCCCATGGGAACCGTTCGAGGCTTGTGGCATCAAGTTTCTCCCCTTCCCCGTGATTCACGGGGCTGGATA
CACGTCGTTCGGGTTTGAGTTTGGAGGTGAAGTTGGGAAAAGGTTCGTCTACATCTCGGACGTGAGTGAGATCCCGGACGAGACGAGGGCGTTCTTGAAC
GATGCGAGCAAACCCGTCATTGACGTTCTGCTGATCGACGCGCTTTATCTAGACAAGTATCACAGCACGCACATGaacctggagaaggtgatggaAGAGA
TTTCCACTTTCAAACCCAAACGTACGCTGCTCACTGGCATGAGTCATGATTTCGACTACCCCAAGCACAGCGTTGAGCTGCCGAAAATGAGCAAGGAGAA
GGGTCTGGATATCGAAATGACCTACGACGGACTGCGTATCACGTTCCCTTGATCCAAACGCAACATAATAGAGCCGAGTAGGCGATATTTCCATGCCGAC
CAACATGAACAACCTGCTTTCTTCGTAAATCAGCAATAcatgctacatgtagtcgatTGACTCCACCAGAGGTGTGGGATATCTTCAAAACCAAAGATTT
ATTCCATCGTGACAGGGCTTGGATCGCCACCCAGAACTGTCGTCTCTGGTAAATTGGCACTTGGTACTTGGGAAGTACTTGCACCATCCGTTTCTTCCTT
AGCTTTGATCTCGTTGGAAGGTGGAACCAACAAACCAGCTTCCCGCATGATCCCATCGAACTCTTCAATTTCCTTAGTCACAGCGTTGGCGGCGTTGAAT
GCCCCTGGTGGCACGGGGAACAGACGATGGAAACATTTGATCAGGTACGGCACAAGCTCAGCCCGAATCACCTGCGTCAGTAACAAACATCAACAGTTAG
ACTCGCCCAAATTCAAAGGAATTACGTATTTCGTACCTCGATCATTGCACGAACAGAGTCcgcaagagctgcagccctTGCGTTCCTTGGTGTCGTGCTA
GTGCCTTCACCATGGCTGTCACCGCTTTTGGCCTGCAAGTCGAGTCCGTTCTCCTGGACAAAATCGGCGATCGTGAGCAGCATCGTGCCAATTGCACTCT
GGTACTTTTTATCCAAACGGTTCTGCAGGGAAGATATCGCGCACAGTCGCAATTCGTTCAGTGAAGCTAGCAGAGCGTTGGTAAACTCCGCCAGCAAAGG
AAACGACATTAGGCATCGCGGAGGGGAGTAATCCTCCCCACTGGAGGAGGATGCTGTAGCACGAGAAGCGAACGGGAAGCTGTTGCCGCTTCCGTTAGCT
GACGAACGGTACGATGCAATCACGATGGGCGTCTTCGAGGAGGCCGAAAATGACGAGCCACTGGAGGCTGACAATGAGTGCGTGCTCAGATTCTCTTGAA
AGTCACGGCAAGCTGAGCGCCAGTACTCTGTCATGAGATTCAGCACGTGGTCCTCGAAATACACGACTAGAACAGCTCGAAAATCGACACCAACACGACC
CAGCGACCCTCCGAAGAACAAACTCTGCTCGATAATCGTCGCAATGGAGCTGAAGTCATCGATCTTCGGTAGTTGCCTGACCACAACGAAACAAAAATGA
GATAAACTGTAAAGCCAGGAACCATTTTCATTCTGCCAGCCTGCGTACTTCATGAGGATGTGGATAAAGTTGGCTACGGTTGTGGTCGCCCAGCGACAGA
GCGGTGGATCCACTTTGCCGTCGACGTTCTGTAACATTATACGGCATTTGGTTAGCATCTTTAGGTAATATATTTCGTGCGCCAATGAGCTCACCTCGCT
ACCAAAGATCGCCGAGTATTGGGTGATCATGTCGAACCAACTCGTTCGCTTGATGTCGATGACTTGGATgatctgcagcagaggaTCGTTAGTATATATC
TAACCACGTGGATTCGGAAATAATAGTAGCGCACATATTGATACGGATCGGAGGACGAAATCCCTCGGCTCAAAGACGATAGCCACACGTTTCTGCAGGA
AAGAAACTCCTCCTTGAGCTGATTTTCGTATTCCGGTGACcccacagctgcagctccatccttCTCAACGAGCGCATCAAGACGTCGGAGATACCCCACG
ATCCGAACACACAGAGCCAACTGCAAGTCCTCACGCaacttctgcagcaacttctcaCGCATGATGCTCGACATCTCCGCCACTTCGCGCACCAAACAAT
CAATTACCACATTGCGCGAGGAGTTTGTACTATCACCCGCCTGGAACGTCTCATTGGCGAACTGGATTACATCCAGTGCCGagtcgaacagctcgttgtG
GATGCACGCCTCCAGCAATTGCGGGATCTCCAGCAACTCCGTTAGCTGGACAACACAATAATTGTGGCGTTAGCAGCGGAAAATAAGAGTAAAACGTTAT
TGCGTTTACCTGTAAATAGTGCTCGAAAACAAACTGGATGTCTCCATGCTTGGCTACAACGTCCGTCACCTCCTCCTGGAACTTAGCACAATATTCCTGC
AATGCTGGAATGGCAGCTTCGATCTTGGTGGTCTCTTCCTTGAGTTCACCTAGCTGAAACATTACAAAACAATTATTGTAAGAAATTAATTGTGAAAGTT
AGAAGCAATAATTATTTTATGGATCGTGCACGTACATCATCCTTCACGATGGCGGCGCACTGGTTGCTCTGGATGAAAACGTGGTAGTTCTTGAGTACGA
GGttacgaagctgctcagcTGTGTTGTCCGCCTGAATCTGTAGCCGCCATGGCTctttcttgagctcctcgagcgAGCACGTCTTGAGGGACGCCATTAC
GGTATTTTGCTGAAATCGAATTTGGAATAATTGTTGTCGGAACATAAGTGGTACCTTAAATTTTATGATATCATTTTAGAGAGTCCTCCCTATTTTTGCG
ATGCAGTGATACCACCGAAGCGCACACGGAGGTAAATAGTTTTGAACATTGCGCAGCAATTATTGGCAGCTCATATGCGTTCACCCGGTGTCTATAAGTA
GCAATAAGTGAAAAAAACATCCCTCGTCGGAAGTCACGACTAGGATTGAGATCCTACGATTCTTCACTTGCATTTTGGGTAATGATAGCGTTGCCCGCGG
GCACAATGATGATGGTTAGGTAGGATGCTCTCAAAAATGGATCGTCAACGTGCACGTTAACTGCAGGCCGCAGTGTGGCTGAACCCGACGTGAAGTACGG
TGTCACCTTGCTGCAAGCCAACACGCAATTAAACAATGCGCTGATAAGCGACAAGGTGTTCGCCTTAGTCATCTCTGACTCCGAATCGAGGCAGCCGAAG
CAGCAATATATTTGTTGCCACCAAGAATCTTATTGTAAACCGTAGCTGAGGGAAAACTGAAGCAGGTTGAAGAGCAAAATTGGCTGTTTCAAACTTCAAC
CCCTAGCCCCTCGTTTACGTGTCATTTGCGACAAAACAGTATAGGTTTCGCTATGTCCCGTCCGACTAATTCGGACATAGTGAAACTTACACAAACTAGT
TCAGTAAACTGATCTGACGATCGATCCATCTGCGACTTGAAAGCCGAAACGCAACGGTCCTTCCTCGGGCAGGAAGAAGCATGTggccgcgtcgtcgtca
ctgtaGCGGCTGATCCCACACACCGAGGGAGGGCATTATCCGATCTTCGCAATCTCCAAACAGTCGATCTCGCctcgctcgaagaagaagcccctAAGCA
ACATGCTCACCCGTAACGTCACTCTGATTTCGCGTTCCCTTGGCACTATGAGCCGCCGCCacttcgctgctgcgtctgcttcgaACGGCGCCAAGCACGT
GGAGGTCAACGGTCATGGCCATGATGCACAGCAGAGCGGCCAGCTCAGCTACATCCCTGAGGGCTCCGACGGTCGATTCTACATCGAACAGCTGTACGTA
CACGCATTTAGAGCGCAATTTTATCAACCGTATTAACATGAATTCTAATGACAGGAACGAGCATTGGCGCTCGGCTGTTGCCGGTCAGaacttcaagaag
gacgacgtcATTGGTTCGGCACCTGGCACTATTGTAAGGATGTTTGTTCTGATCTAATTCCTCCCGCCACTCCCAGAAGACTCACTTGTTGCTACGGTTT
CATTGATACAGTACTCAAAGCCTACTCGGTTCACGGTGCAGATCACGCCCAACAAGCACATGGACTTCACGGGCGGACTTGAGTTCGTGAACCACAGTTG
CAATCCCAACACACGCATTGACATGGTGGAAAACGAGGCAAAGGTGTCATTCATTGCCATTAAGCCGATCAAGGAGGGCGAGCATCTGTCTTTTGACTAC
GCCACGAGCGAGTGGgacatggacgagaagttcgaCTGCCGTTGTGGAGCGCCGAACTGCCACGGTCACATCGGCGGTGCGAAATTTCTCAATGACGAAG
AGGTGAATGCTCGCTTGCCTTACTTCACATCCAGTGTGCTGCGCCAGTTGCTGAACCGCAAACTGACCAACTAAATTTAAGAGAAACAGTGAAGCTGTGA
CGTTCCACACTGCTAGACGCTGACGATGAATAAAAAAGCACTAAAAAGATTGTCATTTAACAAAAACTTTCTCGTACAAGATCGATTTACAAACGAGTGG
CGTTCGGTGGGTACTTTTCGGGGTTGGAATCAAGCGCTTGCTTCCACAGTTCGAGTGTGTTAATGACGCCTGCAAACACTTGCTTGTCTTCAATGCGGAC
ACGAACTGCAAACGCCAGGCGAGGGTTCGATTCCGTTTCAGTTTCAGCCAAGATcgcttcatcctcttcaaGTCTGGTGTCGGCAGTACACAGCATATTC
AAAAATTAGTTCAGCATCTAATGACTCAAAGGTTTGACACACGTACGTAGTCGGATAATTAGCAAGCTTGCGACGGCAAGTGTTCTGCAGGTTTTCATAT
ACTGTGAGTTCATTGCGAACGCTAAGTATTTTCTTTTCAAAAGCCTATTGCAGCATAAAAAAATGTTAGTTGCAGGTTTTTCCActggtaaaaaaaaaac
ttaccCTCTTGTACAGGCGAATTTCTTGTTCGCTCATCAAGATCACTCTCAGCGTAGCCAGCAGTCTTTCATCAACATCATCTCTAAAGAGGGTTCCGCA
AAAATCGTACGTCTGATTGCTGGTGAGCTCATTCGCGTCAAGAACAgtctgcttgagcttcagaTACGGGTCGTTGGGTGGGACTTTCATCCAGAAGTCC
ACTGCTCGACGGTGGTTCGCTCTCGCAACGAACCCGTACGAGTACAGTAGTTTGGCGTTCGAGTATTGTCCGTAGCTGATGTGCAGCGGTGAtccggcag
caacagcgtttGGCACGTGGTGAGTCAGCATTTGCTTCTCCTCATCAAACGAAACGAAGTCGTCCAGCGGGTTGCGCAAGCTCACGTCGTGGTTGAACAT
ATCCATCGCTGGGCACAACACGCGCAGGTACTTCTCGCCTCTAGTAACTCCAAATGCGCGACTCCAGATCACACTCATGGCCCACGTGTAGTCCTCCACC
GTAATTGTCGGCAGTGACGCGAAAATCTCGGGGAAATCGCCCGCTACGGCTTGGTGGATATTCTCAAAGTCCCTctgcagatgctgcttcATCAATTGCG
TCAACAACAGCACATTGGTGCCTTTAAGTTCGTTCAACTCGGATTCCGACCAGAAAACCGGCAAGTCGAACGTGGTGGGCAGGGTTGCAATGAACGGGGC
GAAGAACGAGTCTCTTCCTTTGCTGCGCTCGTGCATTAAATGCAACGCCAATACCTCGTCGTCCGGAATCTGCGGATATTTCTCCAGCACGGGCGCGAGA
TCCGATTGGGATGCGGATTCCGTGTTCATCATGAGTTTAAACGGCACTCGCAGCGTCACTTGGCCGCTGGTCAGCGCCTGCTTGGCGAACACGCCATGGC
CCTCGAGTTTCCCCAGGTACCGGATGTCCAGCAGACTGTCGACGCCTCCATGAGCCTCAAGCCACTGCAGTAGAGCCGTCACCACCGCAGGAGAGGTCAT
GGAGCTCTTGGGCAATTATGGCTACACTTTTGTCAAATTAATGGTTCTCAATCTGAATATCGATTATGACAGTATGTCAAAATATAAACTTTTAGAACGC
AAATTTCGGTGATCGTTTGTTCAACGTCAAAGTCCGACGTCTCGCATCAAGTCGCTGAGTATCATCCCCGTGAttcgctgttgcagctcctgatCTTGTT
GAGATTGCAGTGAGGAGAGAATGGATGTGCTTTTGGCGCGACGGATTGGCGTACGAGGCAGTACATTTGGCTCAATCAACAGATGTGTTGTTGAGATGTC
CTCGGTGGTTCTGCTCAGATCGGACTCAACCTGGGACACGATGCTGTTAACATTGGACGCGATGCAGTTTTGAGACAACAACACGTCTCTGCTGAGTCCT
GTTTCGGCCCCAGACTCATCTGAAATTAGCTGCAGCTGcctctccagctcgtgctcggATTGCGCTCGGactgcgagcagctcgtcaatTTCGGCGTGGA
CGTTACGGTGAATGAGTGCCAGTGCCGAAGCAACGTCGATTCTTACTGAAGGATGCTGAATCACTCTAAAGTAATCATGAGCGAGGTCTTCGACTGTATC
GTAGAGAGCTTGAGCGGTGGGGAAATCGCTTTCGGTGTTGAAAGTGTTGAATTCAGGCAGCCGAACCTGGTTACGAAGAAATTGAATGAGACAAACACTA
GATGTAGTAGCTCAGATCTACCAAATTGCAAGTACCGTACCTTTCCATCGATGAtctcaagctgctcaacgaTCCTTCGAGCCAAATCTTGGTCTCTCGC
TTTTGACTTTTGACTTGGTGTTCGCGTCGGTGAAACTGGAGTTGATTTAGCAGACGAGGGTGCAGTACCTACACCATTTGCACTGCGTTTCATTGTCCAT
TTCGACGTATCAAGTTGAGGTGCAGGTGGTGGCTGACGAGACCACAGTCGGAGCTCCGAGTTGACAATTTCGACGTAAACAGCGCCAAATATTGCATCTG
CTACCCGCTCACTTTGCAGCGCCTCGTCTGGTCCAGTTTCCGTCTCCG