Description :
From Genome Similarity Track
Location :
Scaffold_191:86152- 87734
Transcript NameFunction/comments
Phyci_248964conserved hypothetical protein
Phyci_97918conserved hypothetical protein

Sequence
1582 bases(100 bases per row)
CTTTTCAGGTATGGATGGGCGCGCGAGATCGTACCAACGAGAAGGTGAGCTAATGTTCAATTTGCGCTTTCGTGTAGTAGGCAGCACCAGCAACGGGAAG
ATCTCGATCATCAGTGCAGACGGCGTGTTGAAGCGAATTATGGAGATCCCAGGGACGGAGATCACTGGAGTCTGTCTAAGGTGTGTCGCGATTGAAAGCT
AGCTTGTTTTTGCATTCAGTCTCTCATTGCTTTGTCGTATGCCATGATTGAAGTGCCGATGAGAGCTATTTAATAGCCACGGAAGCATCCACCAACTCGA
TTCATCGGCTCCCAATTAGGTGATCATATCATGACGAGCTGACTTCATTGTGCTTGTCTCCCGAAGAGGCTTCACCCGTAAACAACTCCTTTAGAAGACA
TTGGGCCGCTTGAGGAGTGTACTTCAGATACCTGGACGCGTGCTTCCTTGAGAACTGGATGACCGAGTATCTATTTTATCATGGCATATATATACCCAAA
GGCAATAAACATCACGTAAAGCTGCCAGAGCTTGACCAAGAGGATTACGTACTTTTCGTAGAAAGCCTTGTACGTTGGAATGATAGTGTCGACCGCCGTT
CGAATGAGGTGTTGACGAATGGGAACTTCAGCGACCACGTACGCTCTCTGGGTTTTGTGTAGTTCCTCCAACTGATCGTTAAACTTCTGCAGAAGGGGAC
AGACCCAAGTACATTCAGCATGCAACTCATCATGATTCTTTCGTCATAGCCTTACCGAAAACTTCTCTTTCAGCAGTCTTCCACTTTCCAGGGTCAATAT
GTTGCCACCCTTCGCGTACTGCAGCGTCTCAGTTGGGTCGTTCAGATTTTCCTTGAAAGATATGTAGCTGAGATGAATAAAGGCGCCGAGAGCATCGTTT
CGCATCGCCTCCACGCGGGGTTTGATGGTGCCGTGAATTTGCTTTTCCAAGTCGGCGTCATCCGGTTGCATGCAGTGAGGCAGCGAGTTGGTAACGTAGC
CAAAGTTGTTCACGAGGAAGAGCTGCTTCAGATTTTCCTTTCCTTTCAATTGATCCGCTTTTGCTCTGAGCGCTTCGATAAGCTGGACGATGACCGTGTC
AACGAATGAAACGGGAGTTACATCCGAGTCCCTCGCTAGCAAAACCTTCAGTGGTTTAGCTTGGTCGCATACCTTTCGAAGAAAGTTCAGGGTCTAGAGC
CCGCACATTTGAAAATGTCAGAATGCGTATAACATGACAGCACTATGCAGCTACAAACGCACGTACATGACTGGAAATCGGGTGCACATTGCCGTCTCTG
GTAACCGTTCGATCTCCCGAAGCCTCAACCAATCCAGGTTGAAATGTAAAGAGTTTTTGCTTCGCAGTCGCTGCAAGATCGCTGACAATTCCGTTCACAG
CTTTAGACAACACCCAGGGATCTTCCAGCCCTTTTCCTTCGCGATCACGTAGTAGCAGCGGCGGTAGGACTGCCGCCTCTAGCGCTTCCATTTGCGCTAG
TAACAAATCGTGAACTAGCAGTAGCTTGACAGCATCAAGTTGCTTCGGCGAGCGTAGAGACAAGTCGATGTCCTTCTTCCAA