Description :
From Genome Similarity Track
Location :
contig_9:86137- 87376
Transcript NameFunction/comments
g2743.t1XP_009528133.1 hypothetical protein PHYSODRAFT_332774 [Phytophthora sojae

Sequence
1239 bases(100 bases per row)
CGCCAGGAACATTCCCGTGCCCTTGCGTGTGCAAGCAGCACACGTCCAGCTGCAACCTGAGCTCGGTCAAGATCAATTTACACAGTCGTTGGCACTGCGC
CGCGCCCGATAGAGGCAGCACATGACTCCTGAAGTCCGCGTGCTGGGTGACCCACGGGGCCAACTGCGTGGCCACGCGTCCGGCCCACGCGCCGCTCTCC
GTGACGCTTTGGTCGGGCACTTCACTGCCAATCGTGAGTGCGTAGGCCTGTGTCTCGGTCTGATTGGCCGCCAGAACCTCCGAGTCGGGCGTCTGCAGCA
TGTGGACAGCTACGCGACATCCGGCGGATCTCAGGGCGCTGGCGGTCACTTGCACCAGAGCGTGGGCGTCCTCCAGCGTATCCTGGTGGACGTTGGTGTC
CATCTCCGCGTACAAACAGAAGTCCGCTTTATCCTCCACGAGGTTCTGGGATGGGGCGAAACGCTGCAGCTTCAAGTGGCCACCAGAGACGGGCGCGAGG
ACCTCCGCCGGACTGCGACGTCGCTTGCCGCTTAGTGTAGAGGCGTTTGGCTCACTGGGTTCATATGCGGCGACCTTCTTTGGCTTGGAGAGACGCTGTA
GCGCGGAACGAGACGGCCGCGTGAGCACCAGAGGCCGGCGCCGACGAGACAGAGACTCGGACGTGTGTACGCGCGACTCGGAAGCGGAGGAGAAGGCGGC
AGGGTGACGCCGCCGGACCTCCATCGCGTCCCGATCACTTGGCTTCAAAGAACGTATCAGCTTCAGTGGTAGTTCACTTTAGTGACTTGTGTTTTTCTCC
ATAAATGTACCCATATTTCGCGAAGCGGAGCATGATGAACGAGCATACATGTACGACTTGTTCTCTGCGGAGTGTACTCAAAGGAAGGAAGAGCGAGTTA
AGCTAATACTGCAAAAATACGATGAGGTGTGGGTCTCAGGCCGGCAACATGTACACGACTGGCGGAAGTTGTCACCGTCTCACCTGCACGGCTCAGCATT
GGGGCCTTCGTCTCACTTAGCAACTGTGCAGTAAGGCGTCGTGATCCACGGCTCGCTCGACGTTGAACGAAAAGCTCGTGATACACCGAAGAGTTTCGTT
GGCATTAAATGATCCCGCGGTTGCTGTCATGGTTCTTGTCAACAGAGTTAACAGGCAGCAGATCAATCGAGCGATCGCATTACCGGTATTATTAATACAC
GTATGCAACACCCAGTGGAGATGAAGTGTGCGAATCAGT