Description :
From Genome Similarity Track
Location :
Scaffold_133:86136- 93423
Sequence
7287 bases(100 bases per row)
AGGCAATTGCTTAGCCACAGTCGCCCCAAACCCCTCGGAGCTTCATTGGCGCACAGCAGAATCCTTTTTTCTTCACGCTGCCGGTGCTCGGTTGCCTTAG
CTGCTGCTTTCGAGCAAAGCGAGCGCAACAGGAGCTCAGGGACATCACCAGGCTCGGGATAGTGGGACGTCACTCAACCGGGACATTGCTGATGAGGACG
CCGATGTGGACATGCTGCTGGATCAGACGCTGTACGAACTCATTCGTTGGCTAGTGGCTTGAGCACCGCAGATGGAGCACCTGCAGCACGACAAGGCAAA
GCACAGAGCCCTTGATGAGCGGCAGCGGTATCCGATAATTTGAACGATACAATGCTTTGGACTCAGAAGTGTAGATACTTTAGACGAAGAAGTTTCCGGG
TCAAGGTGCGAGACTGCTGTTCTTCTGCGGGCGATGGCCGCAGAAGAAGCAGTCCTTGCGTAAATCAAGAACTGCGGCAACTTTAGTGAGTGCATTCATC
GAGGTCACAAGAGCATCGTAACGACGTCGAGATTAGTTTGATCATTTCGACAGAACAAGTTCAGCGCGTACTGTGCTATTTCGGAGTCGGAGCCGTTAAG
TAATTAGTTAGTGGTGTTGGGCAGCGCAGGAAGAAACCAGCACTACGTTACGTGCTTTGCTAAGAAGGATACTGATTATCTGCCCATTTGCTCTTGTCAA
CAACAGACTTCCATTGTAATTGTTTCTCGCTCGACCATTGTGCGATCATACTTACTGTAAAGTCTAAAATGTGGCTTGCTAAGCATTTTATTCAATCCAC
GGCTTGATATTATTTGTGAGCGAACTACCAAGCTACCCCAGCCTACGCAAAGCTCTAGTACACTCCCATGATCCGTGAAAAAAAGCGGACAACAGATAAA
GTGGGGTTGAGATCGTCGCATTACATAGTGCGTTTTTACTCAAATTTGGACTTGTTGATTGATTCATTTCGAGAAGCAAACTAGGCCTTTATTTGTTGTG
CGTTGACGACTTCAAGGCGTAAAGTAGCTCAGCAATCTGAATACGGCAACCTGAAGCAGCTATTTTAGCTGCAAATGCCATGGATTTCTTAAGATCGAGT
TGGTTTTCCGAGCTAACCACAAGCAGCAAAGCATCGTTTGTGACCTCTTTTGCCGCCGCTAAACTTCCGCTTCAGGGTTGCATAAAGCCGGAAAGTTAGA
CTGTGGAGCCGAACTAATTCAACACAGCCACAAATCCATTGGGCGCAGCACCAATGAGCGCTTCGCAGGCCTTCGGCTCGGGCGACGCGGAGAAGTGCGA
CAGCGCCACGCCGACGAAGCAGTAGATGATAGCCTGCACTTGACGATATTGAGTCGTCCATTAGTAGTGACACAAAATGCTTGCGGGAAAACTGATGGAA
GGATACACAATACAACATTCCTCAGCACAAGTTCCTGGCTTGATAGGCGGTACTTCCTTTCACATGAAAAGAAAAAAAAAGAGATAGGATGTAGATCTTT
GTTCCTATTAATAAAAAGAACGACAAAATTTGCTTAGCTCGTTCGCGGCTCGTATCTGTCCAATGTTCGATAAATTACTGAATGGTGACTGCGAGTGCGA
TACGTGCATCGTAGCAAAAATTGTTTATACTTCGAAATATCATCTCCATACTACAGATACGGGAGGTCACTTTCCCGCAAAACCTGCCTTGGCTGCAGTT
TTGAAGCGGGAGTACCACCGCCTGCGTCCATTTATGGTGTTGTTATGTGTATCACCAAGTTGTGTAGCATGCTTTATGACGCAGCTTCTTCGGCTGTGAA
TGCTATGGATCTTCGAAGATCGAACTGTCTTTCAGAGCCAATCCCAAGCAGTGGCTCCAGTGCTTACTTGGGTAAGTTCACAGTGAACGTCACTGTCTCC
AACGCCTTGGATAATACATTTCCCTTTCGGTTTCTTTCCCACTTCAATGCTCGAAAATACCACATGACGATTTGACACGGTTCACAAACTGATCTGAAGC
CGACAAGAACGAGTTTATCAAGCCTAACATGGTCGCTTGGGAATTTAATAAGCTAACGTAGCCTCCACATTGAGCACGACTTCGATTCTATATTCGTGTT
TCGAGAATCTGAGGTAATATATGAAGCTTAGTTTTTTAGTTTTTGGTGAGGTACATTGCAGTCATTTAGAAAACCTAACGACTAAGCCAGACGGCATGTA
GTCACTACATTGTAGTGTCCATCTTCATGGCAGGATTCGATTTTTCATATGATGACACATGCACGAGAAATTAGCTACACTAGTTTCCCCCATCCTTAAA
TCGGTCTTGAGTTCGTCCTCGCGCTATGGTGACGAACATGATGCGCATATGTCCATCGAACCAATTCGACGCGAAGGAAAATTATCTGTTGAGCTCACTT
CTCAATTTCTTCTCTTGTGTGTTCAGAGGTCCTCTATTTACGTTTGTTTAAACTATAGAGTCCTGATATCGCTGTAGACTGGGTAACCTCCAGTTGGGGT
CATATACGGTACAGATCTGAGATTGGATCTGACGTGCTAAAAGGTGTTCTGGGGGTTGCACCCCCAGACCCCCGCAAAAAGAAAACTAACTCCGAGTTGC
GGCAACGGGTCCGTTCGCTGGAATGCTCGTCGCTGGGCCCGCCTCCGCAAATACCGCGCGGCCCGCACCCCGCGCGGGTTTGCTATGGCTACGCTCCTCG
CAACCGCTCACTGCCGTAACATATGTTTTGCAATACAAAAATTAGTATTAAAAACCGATCCATTCTCTGATCTGTACCCTATATGATCCCAACCGGGTTT
TACCGTAGACTGGGTAGACTGAGCCTAATTGACAAACGGTGGTGCGGCGAAAATTGTTCTTGCAGGTAGTCCCATAGCTTGACAGGCAGGTGCTCTCGAA
GTAGTACAGCATTGGTAAACTGAGATAGTTGTCGCAATTTGAGAAATCCCCTGATCGCTTTGTAGATGCGTTTGGAAGCTGGTTTCCATGCTATCGAGAC
AACGTCTTTGAGCGCTTGGTGCGTGGCATTCTGGGCTCGAGCCGACTTGATCATTGGTTGGGTGCCTTGGACACAAAGAGAGACTGTAGATAGTTGAGCT
CGCTGCTTTAGCTGATTCATGGCTCGGACGATGATGTAACAGGGTTACACGCACAAGTGGCTACAGTCACTTGTAACTCTAACAGATACGACGTCTGTTA
GAGGTTCGAAAGACTTTCTCGACATTGGTGTAGACACACCAATAGGCTACATACATTTACGACCACCACGACGGGTGGTCCATAGAGACTTAAGATTCCT
ATTGGCTAAGAGCAGCATCTCTTAGCCAATGAGCGACATGCATAGCATTGGAATTCTGCCAACCAGCCGTTGGCAGATTCCTATCTTAGAATCTTAGAAT
ATTACATTTAGAGGAAGTCAGAAACATAAAACAAAAATAGCAGCTCTCATTTTAACCCAAAAAACATTATTTGGATCGTTTATTTAGATTAATCTATACT
CGGAGGCCCGAGTATAATTAACTCTAAGTTAAACTAAGCTACGCTTCCTCACATACACGCGCACACGTGTAAGCTAAAGTAGTGAGCCAAAGTAGGCCCA
TTACACCTGGTAGCACTTTGTAGTCCGTCCAACGACCGACTACCTGAGTTCGTTCGTCACCGCACGAACGCGGAGCTGAGAACCTTCCCATGGATACGGA
GGTGTCCATGGAAAGCTCCACTACGCCTGCAACTCACGTTGCACGCGCTGACTGTCCCCACCTGTCGGACCCAGAGTGGGAAGCTCTCCAACGACTGTCA
ACAGTCATTGGTGAGGCGGCTGTAGCTACGATGCTGCGTACGCTATCGCCGACAGAGCAACATGGTGTTGCTCAGGGATTCGTCATGAGGGAGCAGCGAG
ATGCTGCTTCGTCTACCACGGTGTCGTCGGGGACGACACCGCGCGCGCAATCGCTGAAGCTCAGCGTGAGCAATTACGTTGGAAGAGAGGGTGAACCTCT
CCTCCGTTGGCTTGTCGAACGCGACACAGCCATTGCGGCTAGACGTATCGCCGACCCGTTGTCGTAGGTTGCGTTCGCCATGTCATGTCTTGGCGGACGT
GCAAGAATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACTTCAGGCGTAAAGTAGCTCAGCAATCTGAATACGGCAAC
CTGAAGCAGCTATTTTAGCTGCAAATGCCATGGATTTCTTAAGATCGAGTTGGTTTTCCGAGCTAACCACAAGCAGCAAAGCATCGTTTGTGACCTCTTT
TGCCGCCGCTAAACTTCCGCTTCAGGGTTGCATAAAGCCGGAAAGTTAGACTGTGGAGCCGAACTAATTCAACACAGCCACAAATCCATTGGGCGCAGCA
CCAATGAGCGCTTCGCAGGCCTTCGGCTCGGGCGACGCGGAGAAGTGCGACAGCGCCACGCCGACGAAGCAGTAGATGATAGCCTGCACTTGACGATATT
GAGTCGTCCATTAGTAGTGACACAAAATGCTTGCGGGAAAACTGATGGAAGGATACACAATACAACATTCCTCAGCACAAGTTCCTGGCTTGATAGGCGG
TACTTCCTTTCACATGAAAAGAAAAAAAAAGAGATAGGATGTAGATCTTTGTTCCTATTAATAAAAAGAACGACAAAATTTGCTTAGCTCGTTCGCGGCT
CGTATCTGTCCAATGTTCGATAAATTACTGAATGGTGACTGCGAGTGCGATACGTGCATCGTAGCAAAAATTGTTTATACTTCGAAATATCATCTCCATA
CTACAGATACGGGAGGTCACTTTCCCGCAAAACCTGCCTTGGCTGCAGTTTTGAAGCGGGAGTACCACCGCCTGCGTCCATTTATGGTGTTGTTATGTGT
ATCACCAAGTTGTGTAGCATGCTTTATGACGCAGCTTCTTCGGCTGTGAATGCTATGGATCTTCGAAGATCGAACTGTCTTTCAGAGCCAATCCCAAGCA
GTGGCTCCAGTGCTTACTTGGGTAAGTTCACAGTGAACGTCACTGTCTCCAACGCCTTGGATAATACATTTCCCTTTCGGTTTCTTTCCCACTTCAATGC
TCGAAAATACCACATGACGATTTGACACGGTTCACAAACTGATCTGAAGCCGACAAGAACGAGTTTATCAAGCCTAACATGGTCGCTTGGGAATTTAATA
AGCTAACGTAGCCTCCACATTGAGCACGACTTCGATTCTATATTCGTGTTTCGAGAATCTGAGGTAATATATGAAGCTTAGTTTTTTAGTTTTTGGTGAG
GTACATTGCAGTCATTTAGAAAACCTAACGACTAAGCCAGACGGCATGTAGTCACTACATTGTAGTGTCCATCTTCATGGCAGGATTCGATTTTTCATAT
GATGACACATGCACGAGAAATTAGCTACACTAGTTTCCCCCATCCTTAAATCGGTCTTGAGTTCGTCCTCGCGCTATGGTGACGAACATGATGCGCATAT
GTCCATCGAACCAATTCGACGCGAAGGAAAATTATCTGTTGAGCTCACTTCTCAATTTCTTCTCTTGTGTGTTCAGAGGTCCTCTATTTACGTTTGTTTA
AACTATAGAGTCCTGATATCGCTGTAGACTGGGTAACCTCCAGTTGGGGTCATATACGGTACAGATCTGAGATTGGATCTGACGTGCTAAAAGGTGTTCT
GGGGGTTGCACCCCCAGACCCCCGCAAAAAGAAAACTAACTCCGAGTTGCGGCAACGGGTCCGTTCGCTGGAATGCTCGTCGCTGGGCCCGCCTCCGCAA
ATACCGCGCGGCCCGCACCCCGCGCGGGTTTGCTATGGCTACGCTCCTCGCAACCGCTCACTGCCGTAACATATGTTTTGCAATACAAAAATTAGTATTA
AAAACCGATCCATTCTCTGATCTGTACCCTATATGATCCCAACCGGGTTTTACCGTAGACTGGGTAGACTGAGCCTAATTGACAAACGGTGGTGCGGCGA
AAATTGTTCTTGCAGGTAGTCCCATAGCTTGACAGGCAGGTGCTCTCGAAGTAGTACAGCATTGGTAAACTGAGATAGTTGTCGCAATTTGAGAAATCCC
CTGATCGCTTTGTAGATGCGTTTGGAAGCTGGTTTCCATGCTATCGAGACAACGTCTTTGAGCGCTTGGTGCGTGGCATTCTGGGCTCGAGCCGACTTGA
TCATTGGTTGGGTGCCTTGGACACAAAGAGAGACTGTAGATAGTTGAGCTCGCTGCTTTAGCTGATTCATGGCTCGGACGATGATGTAACAGGGTTACAC
GCACAAGTGGCTACAGTCACTTGTAACTCTAACAGATACGACGTCTGTTAGAGGTTCGAAAGACTTTCTCGACATTGGTGTAGACACACCAATAGGCTAC
ATACATTTACGACCACCACGACGGGTGGTCCATAGAGACTTAAGATTCCTATTGGCTAAGAGCAGCATCTCTTAGCCAATGAGCGACATGCATAGCATTG
GAATTCTGCCAACCAGCCGTTGGCAGATTCCTATCTTAGAATCTTAGAATATTACATTTAGAGGAAGTCAGAAACATAAAACAAAAATAGCAGCTCTCAT
TTTAACCCAAAAAACATTATTTGGATCGTTTATTTAGATTAATCTATACTCGGAGGCCCGAGTATAATTAACTCTAAGTTAAACTAAGCTACGCTTCCTC
ACATACACGCGCACACGTGTAAGCTAAAGTAGTGAGCCAAAGTAGGCCCATTACACCTGGTAGCACTTTGTAGTCCGTCCAACGACCGACTACCTGAGTT
CGTTCGTCACCGCACGAACGCGGAGCTGAGAACCTTCCCATGGATACGGAGGTGTCCATGGAAAGCTCCACTACGCCTGCAACTCACGTTGCACGCGCTG
ACTGTCCCCACCTGTCGGACCCAGAGTGGGAAGCTCTCCAACGACTGTCAACAGTCATTGGTGAGGCGGCTGTAGCTACGATGCTGCGTACGCTATCGCC
GACAGAGCAACATGGTGTTGCTCAGGGATTCGTCATGAGGGAGCAGCGAGATGCTGCTTCGTCTACCACGGTGTCGTCGGGGACGACACCGCGCGCGCAA
TCGCTGAAGCTCAGCGTGAGCAATTACGTTGGAAGAGAGGGTGAACCTCTCCTCCGTTGGCTTGTCGAACGCGACACAGCCATTGCGGCTAGACGTATCG
CCGACCCGTTGTCGTAGGTTGCGTTCGCCATGTCATGTCTTGGCGGACGTGCAAGAATTTGGGCGTATGGACGCCGACTCTCGGATC