Description :
From Genome Similarity Track
Location :
Scaffold_1773:861- 5549
Transcript NameFunction/comments
Phyag_g11445tyrosine aminotransferase, putative
Phyag_g11446conserved hypothetical protein

Sequence
4688 bases(100 bases per row)
ATTGGTCAATTACGACAGGCTAACGCAATTTTTCGTGCTTGATGAAACGGAAAATCAAGTTTGGCCCCACTATGTAGCTTGTCTGATTCATACCCACGCA
AGTGTATCCATTCACTCACTGGTGGCGGCGACAGAACGAATTGATGCGAGCGTAGGCGTCAGCAAGAACCTCTTTTGGCGCCGAGAATACAATGCGGAAG
TAGTTGTCCATTCCGAAGCACTGTATGGCAAAGCAATGCTAGTTAGTTGGTAAAATATTTTGCAGCACTTTTTGCGATGCCTTCCTTACCTGTCTGGGCA
GCACGAAAACGgactcctcgtccagcagcttctgcgtgAAGGCAAAGTCGTCCTCGAACTTGGTCAATACATTGGTGTTGATTTTTATCTGCAGACACAG
TAGTTAATAATCGGTGTAGCAACCAAAATATGTTTTCACTTTTTCGGTGAGTCTGTGGCCGCTTACCATTGCGTACATCGCACCCTGCGGGACCACAACC
TTCAGACCAGGGATCGTCGCGATCGCAGCGACAGTAAATTTTGCATTGTCCTCCAGAGTTGCGAAatacttcttcttgaagtcctcgagcgactgcgacg
ccGCACTCCCAGGAACGGGAGTTAGCAAGTCCGGGATCGCACTCTGCGATGGTATGAAGTCGTCAATGAGCACACATAGGTAAACAACCACCTGTCAACT
GCATTGGAGCAATAAAACTATACCTGAACCAGGGAGTTTGCTCCGAGGGTACTTCGAATCAGCGTCAAGTAGGCCGTCCGCACGTCTTTCAGGATGTTGT
TGCGGTCGTGCAATATGATCCAACCTACCCTCCAACCGGGAATCAGGAACTGCTTCGCCAAGCCGCCCACAGTCACCACAGGAACCGTTTTCGTCAGGGT
CGCCATGGGGAAGAACACGTTGCTTCCGAATACCATGTCACCATAGATCTCGTCTGCAATGATCGGAATCTTGTTTAGCTCTGCCAAAGCCAGGATTGTC
TCCAGGTGGAGCTAGATAGCAAGAACGGAACAAAATAAGCATTAGGGATGTACCGTAGATGCCATTCAAACACGGCTTGCACTTACCTGCGAGTACACGC
TACCGCAAGGGTTGGACGGGTTGTTCACCAAAATTGCCTTGGTTTTTTCGTTTACCAAAGATTGCATGTGCTTCAGGTCCACCCCCCAGTTGTTCTCGGG
CTACAGAAAACGCAACTCTCAGTACAAGGTGAAAGTGTGTGCACTAGTGGTAACCTTCAACCTTACCTGCAGATTATAGAATCTGCACTCGATCTGGTTG
GTATCGCACAGCGCTTGGTAGAATGGGAACCCTGGCTTGGGCAGCAGAATGTTGTCTCCAGGGTTTACCAGCCCCCTCAGAGCGATGTCAATAGCACCCG
AGCACCCGCTCGTAATGATGACATCATCCGTTGTCAACGGAGCCTTTGCGTTGCCGTAGTGCTGCGCAATtgctgcgcgagctgccTCGGTGCCAGCGGA
GTGGATGTAGCCGTTGTGCTGCATCGAACTGCATCACACAGCACCGTCAGCATTCTCGACATTCAATGGCGTAGCACTTTGGGCTTACCGAGTGTTACGG
ACAATCGCCTGCACGAGTACATCGGGGCAATGCAAGTTGCCGAAAACAGTGGGGTCACCTACAAAATGCCAACATCGCACGAGGTCGTGAGCTTGGCGTA
CCTCAACAGTATGGCTATGTAACGATATATCAACCGAGAGATAGCGGaatcagcttcttggacgacgTCGCGGGTTTCTTGATGCTGTCCACGATCTTCC
GAATGGGGTTGGTGTACCGCTTTGACAGGTCGGATGGCTGCACATTCCACTGCACCTTggcgtgctgctgagtgTCAACCATGGGAGCGACCAGAATGTG
GTCGTTGGAGGTTGTCATGGTCACTTGCGGAGGTTGAGGTGAATACAACACTGGTAATTGCCGGGTGATGCCGGCGGGCATTCATCTTGGGCTATCACTG
CTGCCCTATCGGCACATGCATCGCAGGTGACGGGTACTGTAGGTGGCCAATCGATAAGACGAATTATTGCTTTCGACGGACAAGGGACGTGCGTCAAGGA
CCTGACCCTTATTTCCCATGAGCGGGTTCGATGCCGCCCGTATTCATGTTCATTAAGTCTTTTTGGAGCACCTGCTTGCTACAGCTATCCAAGTAGCGAT
CGGTAGATGTCAGTGGCGCAGTCTTGGCAGAATTGAGCTTGCTTGGTGACAAGCTGCTCTTTGATCGCCTTTTCGCTGTCTCCAAGAGCGCCAAACAGCA
CACCAAGCAAATCAGGTTCCAAGCTATCGCTTTCCCAGTACTTGGTCAAGACCGCCACTAAGTTCACACTAGCATTTTCAAGCAGATCCCGCCAGTCTGC
AGCGTGGTTCACTGCCAGGAACCGTTGCATCCTCGCGAAGTCATCGCTTTCCAGTGATAACAACACCCGTTCACGACTATCTTGACTGTTGGCTGCGAGA
AATGCTGCCACCGCGCTGCTTTCATCTTGAGGGATGCTGCTATTGGCTGTCCCTAGAGACGACCGCAATATTAGCAGTTGCGACTCGCATTGCTGCTTAA
CCAGTTCCTCCATCATAACTCGAGCGTAGTATGGCACCATGCGTTTATCGGCTACTAGTTGTTCTCGCACGCCATCCCACCAGTAGTTGACAGCAATGGT
GAACTCGCCAGAGTCAACCTGATGCCACCACCCTTCCGGGATCAAAAGCGCGTCTGCAACAAACAAATAACAGCACGTTACAATTGCAACGATGATCTAC
CACGACTTCAGCAAAAAGATACTGTACCTCCAGCTTTGACTTCGAAGCGCTGAGCTGATGCTTCGGAGAATCGTGGATGCTTCTCGAGATTGGGCTTCAC
GATGTTCACTTGACTGTGGTTTACCGACTTGGTGTGCACCGAGAACGGATACAACTTCGCAGTATCTGACGGAGGGTACAGCGTGACGGTCTTCCTCCCG
TACAAAACCACTAAAATGTTTTGGTACGCGTCGTAGTGCAGCGTAGTCCGGCCCGGTTGTACAGTCATCCACAGATTCAATTGGGTGACAGGTTTATCCT
GAAGACACGTCGGTCTGGAATGACACACAAGCAATTTGTCAAAACTCGTTGGTGAATAGAATACCAACGATGCGCGCATCTTACAGAAGAAAGTCGTCCA
TAATCGCCGGTAGACTCGCCTTGGTACAGGTCGCGTCAGGTTTGGGCACAACTATAGGGCATTGCGCCAGATAAAACTCGAGATCGTCCACCGTCTGTAG
CCAATGCGACTGGTTCCTGAATGCAGCTTGGTAGTAGTCCACGAAGTCACCAAACTTTAATTCCACGCTCTGTCTGGCCTGCTCGTTGCCGTGATAACAT
TCGCTCGATTGATCTTTGCATGCAATTTCCACCACTGTATGCACACTGTCAAAGCCCAAATCATTTTGCTATAATAACGACAGAAAAGATCGCTCGTTCT
CACGGGTATCGCGGTGTGACCCAAAGGATTCCAGCAGATGAACAGACTCCGGAGTGAACTTTGGCAATTGAGCGGGAACTACGCACTGCGTCGCGAATCC
GGCATAGTATATGGGGTCGTGTGCAGTGTCGTCCATGTCCACCATCGTCGTGCGTCAAAATgcgtggtgtggtgcacactTCGCAACAAGCTAACAGGCT
GATGAtgcttggtgttgctgtAAAACCCTGATATGTATTATGTGTTTTGTGTCAAATTCTCATAGCTGCCTGCCATGATCTGATGCAGCTACGACACTAA
GTCGAGAAGGTAATCGGTGCCGGTTCGACCGGTAGCGATACCGTCGCGGAGTCAACCATTGGTTCCGGTGCTGGTTGGTTTGGCACCGCCACGTTagaat
cagcagcagacttCGAGTGGCGCACGCAGTATCCATGACGTTGAGCCCACTTTTGGCAGCCTTCTTCGGCACAGCGCGACCCACCGCCATGCGATCGGCA
GAAGCCCTTGGAAATCGCACCCTTGGTGCATTCTGGGTGCTGGCACCGCACTCCACCGCCGTGAGtcttgcagcagccgcgAGACTGCACAGCGCGGTTG
CATccttcaacgctgcagaaTTTAACCCCACCATGAGCACTGCACTTGTGACCGAATTGTGCCACGCGCTCGCAACCAGCCTCTGCGCACAGTCGCCTGC
CGCCATGCCCCGAGCAAGCGTTATTGAAGCGCGCAAACTTGGTGCAACCTTCCACCTcacagcgccgacgacggtACCGCTTGGGAGCACGGGTGGtcgc
ctcttcctccttctcctccttgggTTTTACCGTGCTAGCAGCCTCAGCTTTGGACTCCCCCGAAATGTCCGCTACCTCTGTGGTTGACATTGACTCGCTC
GACGTTGCATCCGCTGCAACTGCCGCCGTATTCGTATCTGAAGTGCCAGCGCCCTCGACAGAAGTAGGCTCACTTTCCGCAGTCGCAGCGAccgttgcag
ctgctgctggcgttttTACCTCTTGGCCCTCCACTGGTTTCTTCTGCTTAGCGATCACGGCTGCCTGTAGCAACGTGTCGATCCACTCACGCACAGGGCC
TTGGCTGTCCGTGGGAGGTTGCAAGGCTGCTTTttctggcgctgcaggaggttGGCTCCCCGCCACCTCGCTCATCGCCCCTCCACTC