Description :
From Genome Similarity Track
Location :
scaffold_1851:861- 2045
Transcript NameFunction/comments
g11728.t1 hypothetical protein PHYSODRAFT_507730
g11729.t1 ABCG transporter ABC superfamily

Sequence
1184 bases(100 bases per row)
ATCTCGATTTCGTGCGACGTGACGGTGTTCGGAAGACTCAGTTTAGCCGCCATCCGCATGGTTTCCACGACTGTAAAGGACCCCAAAAGCGTGTCCTCTT
GAGCGACGTAGCTGGTCACGGCCCGGAACGTCTTGGACACGCGTTCCGTGCCGTTCACTTCGATCAAACCGGACACGTCGCCGGAGCTGATGCGGTCGGC
CAATAGATCTACGAGCGTCGTTTTACCCGAACCAGACGGGCCCATGATGGCCGTGAGCTCCCCGGGCGCGCACCGGCCGCTGACCCGGTCCAGGATGGTT
TTCGTGCCCCATGGCAGCTCCGGCGTTTTCTTGCCCTTGACGGTGTAGCTGAGGTCGCTCCAACTGAGCACGCACGGGTTGCGGATCCGTTCGTACTTGA
TCTGGATCTCCCGGTCCACGACGGTGCCGATCGGGCCGCGAGGCTTGTCGGACGGAGTGGGTTCTTGGGTCGGGTCGCTCTCGAGGATCGCGTAGCCCCT
AGGAGACAGAGACGCCATGGTCGCAACGAGGTGAATTGCCGAATGAACTGGGATCGGATGGGAGGGAGCGATGGATAAGGTTCATCGTCTCACCCGGTAG
TCTACACTGTAGACTCTACAGAAGGTGGGGGCGAGCAGATTGAAGCAAAGGCGCAGTGACGAGGCTCTTGGGTCACGTCGTGACTCGAGTCGGCACGCAA
CACAAGCCTGACACCGGTGGGAGCGGCCTATCGCGAAGATGTGACCGCCGTTCCGCCGCTGAGGACAACGGTCAGGCACAGAGGACCTTTACATTTGAGT
GCATGATCGTCAGTAGCACCTGGTTGCGCATACAGGTTCTGTCATTTGGACTGCGATGGTCTCCTTTCATTACCACAGCACCAACTCCGGTTTTCCAAGA
CTTACATAGTTGAATTATGATACGTTACTTGCCAACAAAACCTAGCGTCGACCGGTGTGGAACTTCCAAAGGATAAACATGAAAATGATCTGGAAACCGG
CGATGTACGCTACGAGATACAGCATATCCTGTGGGACGTCCACGTTCTCCATCCCGTACTTCTTCAGAATCGCTTGAGCTTCTTCTGACGTTTCATTCTC
GAACTGCTTGAACACGAACGACTCGAACGAGTACGAGTGGAACGCCAGGTAGTACCCCCAGATCCAGTAGTCCGGGATCGAGTC