Description :
From Genome Similarity Track
Location :
Scaffold_746:8609- 13041
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_746-snap-gene-0.8Ras-specific guanine nucleotide-releasing factor

Sequence
4432 bases(100 bases per row)
CTACACCCACTCGTAGAGCTGCGCCACAGACGACCGCGACCGGTTGCGGTGCACGAGCTTCTGCTTGCGGAACCACTGACGGAGACCGAACGTGCCTTCT
CCTCCGATCGACTCGCGGACCTCGCTCTCAATGTCCAAGTCGTTGACGGCGACGTAGGTGTCGCGGTCGCACAGCGGGATAGCGCCAACCTCGCGCGGCT
CGAGCTCGAGCGACCTCTGGTAGCGACTGTCCTCGCACTCGAACGGCAAAGTCACGTGGAGAAGCGCCTGTACAGCCACAGTTGTTAAATACTGGTCAAG
CGAGTTGCGAGCAGGAATGCAAGTACTTACATCAATGTTCTGGTCAAATCGGAGAGCGTATGACGCTGTCTGACGATGCAGAATCTCGACAACCATCACG
CCGAGCTTGCGCAGCCGACTCGTGTTGATGGCGCCTCCCTTGTCGAAGATCGGCAACTCGTTCAGACCGACAAAGTTCTGCTCGTTGGGCAAGCAATGAC
ACAACGATCAGAAATGGAGGAACACGGTGGTGAGACGGATGACATTACCTGGAGGTACAGTCCGATGTAGGGCATGCTCGGGTTCGGAGCGTTGCGCATC
AGGCGATTCATTTCTCGACACCCCTTGTCCGACAGCACTTGCATACGATTCATCGACTTCTTTGCCTCAACGCTCAGCTGTACAAATTGCAACAAGTGAG
TGATGGGATCAAAACGCACTCATCCTGCAGGATATACGTACAGCATCGATGGTTCGGCGCAGTCGCTGGACAGCAGTGGACTGCAGAGCGTACAGGATGG
CTGCGAGCGAGTCGTAGTTGTGGAGAGACTGACAGTGGTCAGCGGCCTGCAGACAAGCAATACGTCAGCAATTGCGTGAGACTCGATAACGGCGACACAA
CGCCAACTAGAATCCAGTTGCCTACCGCTAGAAAGAACCCGATCACATCTGCTCGCTCTTGCGGACTCTCTTGAGACAGTACCGCGTTTACAACAAATGC
AGACAGCTACAGAACAATCGGTGGTGAGTGACGATCATTATCACGACACGCGTGCATGGTAAACATACATGCTGGAACCATCGCTTCGCGCTCACGAACT
GTGGCGAATGGGAGTGCTTTGATCCCGTGTAGATAAAGTCCTCGACTGTGCATGAGAGAGAACGAGCGTAAGCAATCACAATGAACGCTGTCACAATCGC
AAACGCAACTACGTACTCGGGATGCTGCAGAAGAGCGAGTGGGTGACGACCGTGCAGTGCTCAGCCCACTCCTCAGCATCCACGTGACTGTTCCAAGACA
TCGAATGGTTAGTGAAAATCGGTTGGTCAGCCGCACATGCTTAAACACGTACTGATGGAATTTGGATGAGAAGTGGAACGCCGGGTCGAAGTTCCACGTG
TCGCCGAAGCTGTACAGCTGCTCCATCCTTGTCGGCACATTGTCATACGGCTCCAAGACACTCTCGCTGCCGAATAGCTGCATACAGCGCCGGTACAGCG
CTTGGTAGCCCTTCATCGTGGCGCTCAGATCATCCTCAGCGACGTCTAGAACGCGAGCAATCAGCGCGTGAAAGCGATCTTCCACATCCACCATCGCGCT
CGTCGAGTTGTGCTTGTACAGCACGATCATAATGTACAACCTGATCAGGCCACAGCCTTCACGCACAATCAATTGTCAATTGACCAGTCACGAACACACA
CAAACACATCAAAGCCAGCTCACCTTTTTGCCGAGTCTTGATGCGATTGCCGATGCAGTCCAGCACTTCGTTCACACTTGCAAATGTGTCCAAGAACAGG
ACGAACGACAATACATCAGCTAGGTTCAGCGTCCCTGCACCAAGTACGCTGTCGATCAATGCTTCAATGGAGCAAGACGCCACGCCAAACACGGACCCAT
TCACGTCCGTGATTTGCCAGAAGTTGGCCACGTTCGCAGATGCAAACTGGTGAATGGCGGTTTCTTGGAGCCCCAGCTGTCGATAGTCGTCGGCGCTGCA
GCCAAAGATGTCGATCTCTGCGCAGTGATTCGACTCCACGAGCTTGTTATGGACCATCGCATCGCCGAGAATCATCGCTTGGTGCATAACGTGACGTCCG
AACACGTCACAAGTGTCCGGTCGGCATCCTGCGTTCGCCAGCATATCGATGCACAAGCCAACAGCGTCGCGATCAAGTGCAGGCGAAGCATTCAACAAGA
TCGCGAACGGCGTCTGTCCGAAGCGGTTGCGAGCATTCGGGTTCGCTCCGTGCTGAAGCAGCTTGAGCAGGATTTCGGCATTTCCGATCGACGCGGCCAA
GTGAAGGCTCGTGTCGCCGTTCAACGTCGGCACATTCGGGTTAGCTGACTTCGAAAGACACACTTCGACGAGATCTGCGAACCCTTCAGCAACGCAGAAC
TCGAGAGCCGAGTATCCATTCGACCACGCAACCCGGTGGATATCCGCGCCGAGTGCCAACAACGTCGCGGCTCCTTCAAGCGAGCCCCTCGCACACATGG
ACATCAATGGTGTCAGTCCCTTTCGCTGCGCAGCGTCGATATCTGCTCCAGCGTCAACGAGAAGTTCAATGATCAGCGCCATGTCGAGCGACTGCTTCAC
CACGTGCAGCGGCCGCTTCAACTTCCTGTTGCACACGTTCGGGTCGGCACCAATGCCCAGTAGATACTTGACCATGACGCTCTGACCATTGTGAGCTGCT
GCATGCAGCGGTGTGCTTTTTCCTGATGCCGGCTCGAACCCGAAGATTTGCTTTCCTCGAGCCTTCTCCCACGAGCAGATCTGATTCACATCCACCTGGA
ATCCGCGCAGCCACCCAGCAGAGTCCATGTCACCTCGACTCGCAGCCAAGCACATCAGATACTGGAACATCTCTGCGTCGAGCGACAGCAGTTGGTAGTA
GTAAAACTCGGTCAGGAACGTGAGCCGCTTCGGCAGTGGCGCCGTGCGGAGCTTTCGAACGACATCCTGGAACGGCATAGCCACCACGGACTCGTCATTG
ATACCGATCAGCGCGAGCCCTGGGACGATCGACGCGCTCAATGCAGCTTGGGACAATTTTCGGATGCTGTACACGATTGCACCTCGACCGTTGCCGTCAG
TCGTGAGCTGGATGCCAACATCATTGGTTGAGATAGAGACAGTCACTCTCGAAGCTGCAATCGTCCACGGATCCAAACGACTCGCCTCATCGTTGGTTTC
AAACCCTTCGATCCACTTGATGGCGTCAAGGAAAGCTTCGACTACGTTGCCCTTGTTCTGGCATGCCGGATGATAGACGTAGCTGATCTTTAGCAGTGAG
CGCAGAATCGGCAGGTCTTGCACATCCGACATCGACAACACATACCGGAAGATCGCCGTCAGTGTCTCATCTGCCACATCGAACAATTTGCCGTTGAACT
GCGCGATCGAGTCCACGATGGATCTGCCCGCGGCGAGGATGGTCTCCAGCTTGTGCGTCGGAAGAGATACGCAGTCGAGCAAGTTCACCGTCATAATCGC
ATCTTTCCAATCGCACACTCGCGACAGATCGTCTGGGATGCCGAAATACGACTGCGGCTTGGTCCGGAACAGCTTCAAGTTCTTCTTGGCGCGTACTCGC
GTCATTCGGAGACGATATGTTTCCAGGCTAGCATACGCAGAGGCATACAGCGGAATAAAGATGCGATCTTCAACGCTGCGCCGAATCAGGCGCACGAGCT
CGTTGCCTGGCAGCATCTCGACAGCTTCGTCCTGGTAAAACTCCAAGTGGTACTGGTCAATGATCCTGTCGTCGAGCTCGACAATGAAGCTCTGGATGGA
CGCAAAGGAGTGGTCGATCTCGTTGGCCTTGAACTCCGCAACCTTGTCAGCGATGTCTGGGTCGGCGATGAAAATTTTGTTCAAGTGGCGCGCCACGGCA
TTCGACCCGGCCTTCACCTCGTAAGCCGTGAGGTCGATTTCAACGCACGGCGACGCTGATCGCCGTACAGAGCGCAGCGACGAGACCCACAGCTCGGCCT
CAAATTGGCTGCAGCAGTAGCACAGCAGCCGATAGAAGCCCTTCTCGATCTGGAACGCGTACGGCTTGCCAGCGCGGCGGACATCGACGTGCTGGACGGA
CACGACGCCGTCGTTGAGCTGAATGCAGCCCTGAATCTTCTTGCGGCCCTTGCTCTTATAGTACGCAAAGGTGCCGTCCGAGAACAGCACGAAGAAGCGC
GTTTTCCACGTCTTCCTGCAAGGATCACCGTCGTTAGAACCCACACAGCACCGCTACAATATCGATCACCCACAAATAAACGCACCACGCATGACCCTGC
TTGGTGAGCCAGCCCATCTTGACGTAGTTGCCGACCTGCACCTGTGTGGCGTAAAACTCGTCGTTCACGAGCGGGTCGGACCCGCGGCGCACGAGGCGGA
AGGCCTTGTCGCGCGCCACCAGCTTCGTCGGC