Description :
From Genome Similarity Track
Location :
Scaffold_888:8607- 13344
Transcript NameFunction/comments
Phyag_g8562hypothetical protein PHYSODRAFT_298687
Phyag_g8563hypothetical protein PHYSODRAFT_495212

Sequence
4737 bases(100 bases per row)
TCAGGAAAGGCTTGACCGCTCGCCGCTGACGTTCGCTGGACAGAGGCAAATCCAAATGACGCTTTCCTCGAACGATCTATGCCTCCAACTTCTCGGGCGG
CCGGATGCTGCTGTATTGCGGCCGCGTCTTTGCTGCTTGTCTTCAGTCATGAGTGCGTCGGCCTCTGTGGTCGTAATGGTTTGATTTGGTGCATTGGCAG
CGCTCGTGGTCAACGAGGTCATGCTCCAAAGTCATGCTCGTCAAGGgctccatgttgaagtggctaTTGCGAAATTCACAATATAACCGAAACCTTTGAC
TTGGCCAAAATATTACCTTTCACCCGAACTATCGGCAGGGGAATGGCGGGGCGAACGGCTCGGAAGCGGAGTCGGGCGGCGTCGGAgtcttcttcgtccg
agGACGAGCGGGAGATGGTACGCGACACGCGCCGCGGCCGAGGCAAGCGGCAGAAGGCCAGCGCCATCCTGGCCGAGTTCACGAGtctggacgcgctgct
gagcAACGACCTGGCGGAGAAACGCAAACGCGAGAACCGCgagcggaagctgcagaggctgcgcgaggagagcgaggcaGCGGAGAAGGACGCGCCGCTG
GGGAAGATCATGAGCAACATGGACAGCAACATGTCGACGCTCTCAGGAGACAGCTACCTCTTTTCGGCCTCGGAAGTGACGGTGGCGGAGGAGAAGTTCG
GCTACGTGTTCACGCCCATGACAGAGGTTGGTGCTGTAGAGCAGAAGGTTGGGAGAAGAGGGAAGGGTTATTGACACACTGCTGCTTGTGTGTGAATGCA
GCCGCTACCGTACCGCACGTacacggcgacggagaccgagctggagagcgaccTGAAGCTCGTGTACGAGACCATGCAGTCCACTGATGACGCGGAGCTG
AGCGGACTGCTGTGGTCTAAAGCCATCCTGATTCGTTGTATGCTCAAGCGCCAAAGTGAATCAACTACTAGAGGCTCTGCGATGACACCGATTGTGTTGC
CTTTGAAGATCGGGGCGTGGTTATTTATGACGAGTACGTTTATGCAGTTGGATGGAAGGCTCCATGTGACGTCTAACAAGAAgtgctgcttttgtttttG
CTTGTAGTGTCAACTCACAGTGACAGCCACGTGGTTGGAGGCTGCTTTAGCAATCTCTTTCTGGCCCAGAGCTCAGTCAAGAAGTCATCCATCCCGAACT
TAAGCTCGGGTCTGCCTGTGGCTTGTTTTGCTCACCCGATCGAAGATTATCGCTCTGCATTTGGCAATCAGGTCCCTTCTATTGAGATGGAGTGGACACC
TTCCATCTACGACTTTCTCAACGCCTTTCGCGCGTACGGATTCCAGGACAGCAAACGATCGATGAGTGTGAAAAGCAAGATCCCCATTACACCGCCATCC
TCGAAGAACTCTCGCATGTTGCCGTTCCCGACACTGAATATGCACTACGTGCTGATGTACTTGGTGATTTGTCTGCgcgccaagacgctgacgtTGGAAG
GCTACGACGCATTCAGCTTTACCATGTTTTTCCTGCGAATGCAATTCGAGAATGACATTCATGCCAGCATTGTAGACCTGGCGACAATCTGTATCGAAGA
GCTCCTGGACGTGTTTCCTCGCGCTGAATGGCGTCGGGAATGGGCGCCACAGCTTGTTCTTCGCATTGCTGGGGCGAACGAAGGTTTGTTTGATTCGGCT
GCGGGCTGGCTTGCAGTTGCACGCCGGCTTCCACGCACCATGCGTGGCACACAACTTACCACCGGACTGGCGATCTACGTCCTCCAACACCGAATCGACA
AACAGCCACAAGAAGGGGTACGTCACGCTGCCGACTCGAGTCCTATTGCGAGACTGTACACTGTTTTCAACTGTTACTAACCAGCAATGCTGTACATAGG
TATCTTCTGAGAGGCCAATGAAGTTCCCGATCCAAAGTGGGCTCGTCGTGGATATTGTCGCTGGCATTGTGGAGGACTTGACGCATAAGTATGCCGAGAC
ACGCAAGACTGGCAAGGCATCGAAGACCACGCCACCGTTTGATCTACTCTGCAAAAAAGTAGCACTGATGGACCTTGCACTGCAGGCGTTTCTGAACATC
CTTACGCcgaaggagatggagatcatGCTGAACAAACTGGACCAATTGGCGGACACACACAAGTCTACCATGTCGGCCAAGTGGCACGAGCTCAAGACAC
TGGTAAGTTTGATGCACCGCAAATACTCGCTTGAGAATTTGCGAGTCGGTCGGagcgcttctccatctgcgaAAACTGTGTTGTTCTGCGACGACAACTA
GGCACACCGCCGAGGAGATGGTCTATGGTGGAGGGTAATGGAATGAATAGAAGTTAACTGGGTACTGTATGGTGAAAGGCAGAGTTTTGATGCCGGGACC
ATGATTAGAAGGctctactgctgctcttgaagCAGGGCCGCGTACTGCTTCTGTAATTTGACCTCGATCAATTGCTGCGAGTTTACATCGTTCGCCAGTC
GTGTCATGCGGCTTTGCAGCGCCTGGGTTTCGAGACTCGACAGATTCTCGAAACATGCCTGCTCAATCGCAGCGTTCTGAAGCTCTGCCATGTGATCGTG
CAGTGACTCGAAGCCCTGCTGCGAGCGGCGGTAAAAGCCACCGTTAACGACCTGCGCACGTTCCTTTAACTTCTGCGCGCGCTTCGTAAGGGACTGCTCA
GTCTCCTTTAGCTCTGCAAAGCGAGCTTGCACTGCACGCAATTTGTCCTCGATAGAGGTAGCAAACTGGAAAGACACATTACCGCTTTTTCCTTCCCCCT
CAGCTTTGCTTAAATAGCGCGTTTGCACCTCCTCCCACTTCGCGCTGACAATTGAAGAATCTTGCGACTTCCATACGTCGTTGATGCCACACAGACTGGC
CTCAATCTGTATCATTTGCCGCGCGCGCTCCATATCGCTGTCCGAGAATTGCTGTAGATGCGGCACTGCTACCGAGCTCGGTgctttcttgcgcttcttg
cttttCTTGGACTTGCCGTCATCGACCGGGTACTTGGCAAGATCATGTTCTAGCATGCAGTACATCTCGTCCGCAACCGCGTTTACTGCACTGTGAATCA
ACATCTTTTTCACCTTCGAAGGGCGAGGGAGCCCCTTCTGAACAGCGGTGGATCGCCGCTTGAGATCACGTTCTCGCTCCAACTTGCGCAGTTGCTGCTC
ACGGGCTTCTCGTTCCCCAGCATCCTCCTCCCGAAGAAAAGACGTGCGATCATCGTCGGCTTTTTCTTTTCCAGGTACGTTAATCTCGTACTCGTTCTGC
GGTGCGGGTAAACTATTGAAACCTTGACGAAGGCTAGAGGCCAGTCGCTTCGCTCGAGCCTTTTCCGCCTTTGCGTTCTCAGCCTCTGTGCCATAAAGCT
GCTCTGGATTGATACCAAGCTCGTCACGTAAAGGCGTACGCCCAGCAGACATCGGCGTCTTCTCGTTGACTGCAGTAGACACAGCCGACGAGGGTGTTCG
CGATGGAGTTGCCCCCGCATAACCTGTTCCTTCGTAGAGTTCAACATTctcgccaccaagaagaggagTGGCGCTGTTTCGCATGGCAAGCAGGTTTGCT
GTTTCCTGCATAATGCTGTCGTGTACGCCCCGACTAGATGGAGTAGCTGCTGTACCTCCATTGGTAGAGCGTAGCGGGGTAGCACTATAGTCACCCATGA
GTGCCCGCGTCTCGGTAGCTGACCCGTTctcaagagcgagagcggCAGCGTGAGAGGCATGCATGCCCAGCTTGGCGAGGTCGCTCAGTTCGTCATTGGA
AACCACTGGAGCAGGTAACTCCAGCGGAGTGCGCTTGATCGCGTTGATGGGGTCGTTCTTCTCATTTACCGCAGCGATGATCTGCGGCAGGTTGGATTTC
ATGAGCGACTTCTGGCGCTTGGCATCCTGtttgcgctccttcttctcttgggCGTCACGACGCACTCCCTCCAGCTTGTCCAGTTGTAATGCAGCACGTT
TGGGGTCGATTCCTTTGCTGGAGAtgcgcttctcctctgtGACATCATAAAAACCGGCAggtgccttcttctcgaacgGGATCTCGCTTCCATAGTCGAT
GAATTTGCGTTTCTTCAGGTGCACCTTTGGGTTGGCCGACATGATCCCAGCCGCCTTCAGCTCCCGTTTCTTCTGCAACGTCGCGAGTCGTCGcgcctct
tccagctgcttctctcGAGCCTTGCGCTTGGCTTTCTTGCCCTTTGTATTGGCAAGACGAGCTCTCGCCTCCGAcagcatctccttctcgtcttcgtcca
tgTCCACGGGGTCAGGTCGCGCCGGTTTGTTCTCCGGATTGGGGTCGATCTCTCCCGGTCGCAGACGTCTCGGGTCGTCACTGACTTCGACCCCCTCCTT
CTGTTGAGCTGCATCGAGCAGTCGCTCGTAGTGCTCCATGCACTGGGCAGCAGTGCGTCCCACGATGGGGGCGATGGTGCGCCACTGCGAGGGCATGAGC
TTGGCTAGATGCAGCagtttctcctcctcctcgcgaCTCCACTCGGTCTTCTTGATGCTCGGGTCCAGCCACTCGTACCAGCGCGCCTTGCACTGCTTGG
CCGACTTgcgcgacagcagcgaggcCACGCGCGCCCACTGGTTCATGCCGTACTTCATCACGGCCGCCTTGAGGATCTCATCCTCCGTGTTCTTCCACAC
GCCGCCCTTGATCATGATCCGCATGGCTGAGAGAGGG