Description :
From Genome Similarity Track
Location :
Scaffold_19:8605- 10335
Transcript NameFunction/comments
Phyag_g546hypothetical protein PHYSODRAFT_351613
Phyag_g547hypothetical protein PHYSODRAFT_505018

Sequence
1730 bases(100 bases per row)
CCGCTCGGCGCGCCGTGGTGTTTCCGTTGGTGCCGTAGGTGTTTCTGTTAGCAGCATTGCGACCTAACAGCCGTTGCGAGATATCGCTGCCACTTCCACT
GCGGATGATCATTGGACTCTGGCGATACACCACCTTACCGCGGCGTTTGCGCATGAGAtgcgtcttctgcagcgaaGGTGACGCATACATGGGCGACTTC
TCCACTGACTCGGTGCCACGCTTACGCTCTTCCTTCTCAGAATGGTACACCAGCAATCCCATCACGAGCACGAAAAGCGCAAATCCATCGTAAATAGTGA
AACTTTGGCCAGCGGATTTGCCCGTGAGCAAGGGGATCATGTATAGCAGGTCCGTGAGGGGTAGACCCACAGCCGATGACACCACGAAGagcacgctgct
gccttccttGAAGATGTACAGCATGAGCTGGTTATAGATGGTGTTGAACACGATGAAAACCATGAAGACGGACAGCACATCCGAGTCACACGCCAGCACC
TTACCATTCAGCTCAACTTCTTTGCCGATGAAGCACTCGTGACCTTTCCACACGTAGGACGGGAAATCTGCCCAGGGTACAGGAGGGTCACTGAACGCCT
GGATACGCACTGTCCAAATGGTGGCGATGCCGATGAGGAGCTGGTAGAAACTGATCCAAATGTTGGCGTACCAGATATCCAGGTCCACATCTTTGAGTCC
GATCTCCTTGTACACAttcgaagccgccgccggCACTAACGACACAATGTACAGAGTGATCCAGCCCGCACTGGGGTCAGGAGTGTTCTGGTTATCCTGG
CCCGTAAGAGCGGGGATCATGTTCACCATGCCACCGTACAGTACCAAAATCGATCCCAAAATGTGACCGCGCTTGAAACGCGTCTGTAGAAACATGTAGG
ACAGCAACATGTTGAACGGAAGATTCAGCTGGTTCAGCACATTAGCCATGTTCCCTCTGTCCACAGAAACAGAAACACAATTGGTAAGTCCGTCTCAAGG
GCAAgtcaacaccagcaacaataCACGCACCCGATGTGAGGCGTAGGGAACGCGCCGAGTAGGTTGTAGAGCGTGTCGAACAGCGCCATGAGCATGTACT
TGTAGTGCGGGAACTCGCGCATCTCCGGCGTAATGTCATCCGTGAAATAGAGCTTGTACCTGTCACACACAACGTTAGTACCACTACTACTACCAGTTTA
GTGCGCGTGTATAGCATCCACTTACGCCACCACAGGAGCTGACGAGACCAAGAACGCGATGGGGAGGATCACGTTCGTAAAGTACCAGAGGAACTCCGTG
TAGTCGTACGTGATTCGTCTACAACAAATCGTCCAAAATAAGGTAAGCAACCAGATACAACACATGTCCCGACAGAACGCACGTGTAGAGCACGCGGTCG
ACGCAGCGCGCCATGATGAGCAGAcacagcgccaccgccagcttGGACTCCCACAGCAGCCGCTTCACGTCCATCGTAGCTCGAATAAGGTGTGACGATC
CCTTTCACTAGGATCGCAAAAACCTGGctcagccaatcagcgcaCAGGATTCGCGAAAAAGAACCTCAGCTATATTTAATACCATAATTTTAATTTTAAT
TAAAATAAGTGCGCCCCGTGCGAGATGGAGGCTCAGGGCATGACGCGcatgcaggagctgctgagcagctACTACGGCCTGCAGGACCAGGAGAGCAGAC
AGGAGCAGCTGCGCAACATCGACTCGCCCG