Description :
From Genome Similarity Track
Location :
Scaffold_690:8605- 9715
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_690-fgenesh-gene-0.4MYND finger domain protein

Sequence
1110 bases(100 bases per row)
ATGTGATGTCTCTACTACGTTCTGTGGATACTAACTACAATGCGGCTGGCTCCTAGGCCTTCGTGCACAAGACCTTGTGGTTCTTCCAGTCGGCCTTCTG
GCACTTGGCGCTGCAGTAGTGCTGGTTCTTGCAGCGCGAGCAGCGCAGCGACGCGTTCGCCGAGCACATCGCAGCGCCACACACGTGCACGGCGGCTGGC
GGCGCTCTCATAGCGCTCGAGAACGCAGCCATAGACGCCGGCGAGGTGCCAGCGGCGCTCGCGGCGCTCTGCTCCTTGCCGATCTTGATCCAGTCGGCGT
CCATCGTGACCTCGCTCAGGCGGAAGTCCATACGGTCAAAGTCGTCATCTAAGATAGGTTCACAGGTTCATCAGTCCCGCTGAATCAATGCAATACGCCC
ATTGCAATGCAATATGATGGAAGACGTACCGTTGTCAAACACACGCGCGATGAACGCGTCGCCGCGCACTTCGATCATCTTGCCGCACGCCTGCGCGATC
GCCGACGCGCGCACGTTGGTCGGCAGGCCCTTGGCCGTGCCCTTGTCGTCCACGTACATGTTGACGCCGATGTGGCTTACAGCGCGCGAGTTGAGCATGA
GCGGGAACGAGTCCACAAGGCTGTCCATGCCAAGCATCATCTGCAGCATGTCGTCGGTCATGGTCTGGCCCTTGGGCAGCTGGCTCATCAACTGCTTCTT
GAAGATTTCCTGCTGCTCGGCCGTCGAGTTGCCGGCATTGCCGCTTTGCTTGAAGTGCGCGCGCAGGCGGTCTGTGAGGCACCCGAGCTGCGCCTCCTTG
TCCTTCGGGAGCACCACAGACCACTCTTCCAGCTGTTTGTTGTCGTCCGCGGGCACGTGCACGACGACGAAGCTGCCGCACGCGGCTTCACGTTCGCCAA
CCATCCTTGCTTTGAGTGTGTGGATCAATCAGGAAGTGGACACACATGGCCCGATTTTAGCTCTCAAACGAGGGCCTGCCACATAAAATGCCCTGTTTAG
TGTGGCAACACGGATTTTTGATCAAAAGACCCAAATTAATGTGACAGAAGCGTCCTCGCGTCCTTGTTTCAAAATAGCGCGCCAAAACTTTGCAGGACAT
AATTTGGCGG