Description :
From Genome Similarity Track
Location :
Scaffold_4:86049- 87764
Sequence
1715 bases(100 bases per row)
GCGACGCGACTACTCAAACGCCGTGTGCGGCGTCTGCCAACGGCGAGGCCACACCACAGGATACCACGACCAGTGGTCCACCAGACAAGGCACCGTGGTG
CAAGCCCGCCTGGCCAGAATCGCTACCATACCGAGTCGACAAAGATTATCTTATACTACAGTCACGAAAAATCATGAAGAGGGAAAATCACAGCAAGCTC
CAGATCCGGGCGCTGCAGAGCCCGTCGAGGACCACGACTGGGAGGACCACGAATGAAGACCACGGGCACTGCTGGGGAGAGAGCACTTTATAACTGACCC
AGGTATACCCAACAGTGCCCCTGTGATCGACTCAGGTGCGTCTTTCCACATGGGAAGCTGCGCGGACATTCACGACGCCGAACCGTGCGGCGAACACGTT
ATCCAGGTGGCGGACGAGCGCACATTAATTGCAACCGCACGTGGTAGCCTGCGACTGGACAACGGCACCGTTCTCCACGATGTCGTAGTCGTGCCAGGAA
TAACCCGCACACTCATCTCAGTGGCGGCATTGTTTAAAGACGGCATGCACGTAAGCTTCAGTGGGCACAAGTGTGAAGTATTCGGGAGACTGCTCTTCTC
TGGAGTGGTTCGAGGTGGTATTTACGAGCTGCAAGGAGGCACCAGCCGGTCGGCGGCAGCATCTGCACTGGTCGCCCAAGCGCCGAAATACAGCAAAAAT
GACTTAAGGCACTGGCATCAGCGACTCGCTCACCTAAACTACAACTCTATCCTGGAACTGGAGAACTCGGGCAAGGTGAAGGGTCTAAAAATAGTTGGCC
CTCGTGTACTTAACGACAAATGCGAGGCGTGTGCATTAAGCAAAGTAACGGCTCGCTCCGCGCCCAAGAAAGCAACTCGCCCTCAACTCTCCAAAGACGA
GGTGTGCCACGCAGATCTCGCTGGCCCAATGCAGAGAAGTATCCACGGTAATCATTACTTCCTCGCTCTGAAGTGGATTGGATTTACGCATATCTCCTTC
CTACGAAACAAGTCAGACGCTGCTGCAGCTTTTGAGGATTACCTTGTAATCGTCAACCGCCGGTCCGACAATCAGCCACATTCAATCAAGGTCCTGAGGT
CAGACAATGGAGGAGAGTTCGAGGGTACGGCCTTCCAAAGTGTGTGCTCAGCGGCTGGTATAGAGCGTGAATACTCAGAGCCCCATGCTCACTACCAGAA
CGGGGTGGTGGAACGCGCAAATCGGACGATCTCGGAGACGGCAAGAACGCTTTAAGTACATTCCGGGTTGCCTCACAACCTCTGGGAGTACGCTGCCCGC
CATGCAGTATACGTCCGAAACCGAGTCCTTTCCCGCAGCTATCCAAATGCAACTCCGTATGAGCGCTATTATGGCCACGCTCCCGATGTCAGCCAGCTTC
ACGTCTTCGGAGAGCGCGTTGTGGCGAAGATCCCTCGCTCAAAGAGAAATACTCGATACAAGTTTAGAGAGCGAGGCAAGGCCGGTGTATTCGTCGGGCA
CGACAATGAGCGCAAAGGTTACTTCATATACTTTAGTGCCGGTGGCCCACGCATTCAGCGGACGTGCGACGTCGTCTTCATGCAAAACTTTCCCACATTT
GCTGAAAACCCTCCAGACACTACTTTACGTACGTTCATCGAGCCACTTAGAGCTGAGACGGATTCGCGGGGAATGCAAGCAGCGAAACCCACCGCGGCAG
TGCCAGCATTACGAG