Description :
From Genome Similarity Track
Location :
contig_32:86033- 87557
Transcript NameFunction/comments
g7616.t1hypothetical protein

Sequence
1524 bases(100 bases per row)
CTCGTCAATGCAGAGGGAGGACCCTTTGGTGTCCGTAGAGACTGCAATGCAACGACAGACGGACAGAAAAACACTGTCCGTCCCATCTCCACCCAGTTCC
TGCGAACAAGTTCAACGCCACACACACACCTTCGAGGCTATCGCCGGGTCTGATTGTCGAGGAAATCCAATTCCGAGCATAAGCACTCGCCATCATGAAG
ATACTCAGGTCCGTAAGTAACGAAGTCTCCCCATCAGAGCTGGTGCGCAGCAAGCACGCGGGCTCAGCAAAATCGTCTCAATGCACCGAATAACAGCTGC
AAGGAGCTCAATAGAAGAGCACTTGCCCCCCCGAGATGGAATTGTCTTTGCATGCGTCTCGATTGTATTCCTTGCCGTCCTAGGCTATTGATACCGGTAC
TGTACACCACTGAGGGTGTCGCCGACAGAGGGGGCGAGTTGCCAGTTGCGCACGACGGGTGAGATTAAAGCATGTGGTCCTCGCTGGGAGGGAGCAGGCA
CATGTATGTAGAGGGGGGGGGATACGGCATCCTATCCGATACCGGAACGGTATAGCGTGACAAATTCGAGTGCGGCCGTCGGGCACTTCACATCGACGCG
ACGGTCTCCCCTGCCCCCTTTCTGAACAAAGCCGGCGTGTGCTGTTCGAAAGGATTTGGCTGACGAGCAAGCATGGAGAGCGGTGCTTTGGAAGCAAGAG
AGCATGGAGCTCATTCAGCAATTTGCCGAGCCAAGCGAACGACGTTTGCTTAATTGGAAGTCCGCTTCCAATACAACCTCCCACCCGCAAGCATGCAGCT
CGCTCGCATCATCGCGCATTGCGCTCGCCGCGGCGATTGTCGCCTCAACGGCGTCCACCGCTGACGCCTCCTGGGGCTTCATGACCCAGGACAACGCCAA
CGAGGTGAAGTCCAACAACATCGTCGAGGGTCTCCAGCTGGAGCGTAACCTCGGCGCCGGCGGCGGCCTCCGCGGCTCCCAGGCGCAGAACACGCCGAGC
CAGGGTGACGACAACTACACTGGCCAGAACACCCCAAGCCAGGGCAACACCAACCAGGACGACAACAAGGACGAAGGTGACAACACCCAGCACGAGCAGA
AGGAGAAGGAGGATGACAAGGAGAAGAAGGACGACAAGGAAAAGAAGGACGACAAGGACGACAAGGAGAAGAAGGACGAAGGACGACAAGGAGAAGAAGG
ACGACAAGGACGACAAGGAGAAGAGGAGGGTGACCACGAGCAGAAGGAGGAGGGTGACCACGAGCAGAAGGAGGAGGGTGACCACGAGCAGAAGGAGGAG
GGTGACCACGAGCAGAAGGAGGAGGGCGACCACGAGCAGAAGGAGGAGGGCGACCACGAGCAGAACAACAGTCACCAGGACGATGACAAGAAGACGGAGA
CACCCGAAGTTCCCACTCAGGACACTCCTGACCAGGACACTCCTGACCAGGACACTCCTGACCAGGACACTCCTGACCAGGACACTCCTGACCAGGATGC
GCCCACACCTACACCGGAGACCCC