Description :
From Genome Similarity Track
Location :
Scaffold_34:86023- 87120
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G011170Similar to CHDH: Choline dehydrogenase%2C mitochondrial (Homo sapiens)

Sequence
1097 bases(100 bases per row)
CCACGCGTTCAAGTCTGCATACATACCCACATATATCATAAGTAAACAAAGTAACACAGCGCGTCGGTACACAACGCATGCCCCTCTACCTTCAGACGCG
GAGATGGCAGCACCTGGCGAGATTTCTTTCCCAGCCCATCCTTTTTGGGCTACAAAGGAATCACGAAAGTCATCATTTACAATCAAAAGCCTATTATTCA
TCAGGAAAAATCAACGACTCGTACCTAGCGCAGCAGCAATCTCACGGACAACTGCGACACCCCAGGACAATTTCCAGACGTCGTCACCACGCAAATGCTC
CGCTTCTTCAGCTTCAGGAACTTCCGACGTGATGTGCGGAACAAGCTCGCTGGCAGCATCCTTGCTACTAGGTACGAGGATAACTCGATTCCGAGCACGA
GGCGTAAGAAGCGCGACCGTGAACAGGAGTTGCGAAGTGTGATTCAAGTCCGAGCTATTGGAAATGTGCGGCTCAGACTTTTTCGGGAAAAAAGTGAGCT
GGATCTCAGGAATGGTTGACCCAGGCGGAATTAAGAACGCGCCAGCGCTGATCCCAGCAGAGCCCATAACACCAAAACTTGTCACGTTCGACTCTTTCGC
TTGCTTCGCTCGAAAGTATCGCTCCAGCTCCGACCTGGTTGCAACGTAGCAACAAATCCAAACACACAAGTCAAACAAAGAAAGCCAAGGCTGACGGTAC
TAGATAGACACCAAGGTCACGTACTCGACGTCAATTGAGAGTGAATTCACGCTCTCAAACGTGACTCCAAGCACCGGGTGATCTTGTAAGTTCATTCCAA
CCCGCGAGAGATGCTTCTTGACTGGAATCTTGAGCCGCTGAAGAACTCCTTTGTCTCCGATTCCAGACATCATCAGCACTTTCGGTGTATTGATTGCTCC
AGCAGTGACAATCACCTGACCTTTCTTGGACAGTCCAATCGATTCGCGCGTACCATCCGAGTGATAAATCTCGACACCTTGTGCTTCCAATGCATCGTTG
ACGTTGACTTTCTGTCAAAAGAATGGTCAGAGCAAGGAAAAAAGGTGTCAGTCGAAGTTCAGTGGAATGCTACTCATCATTTGCGCAAGAATCAAAA