Description :
From Genome Similarity Track
Location :
Scaffold_133:86000- 87416
Sequence
1416 bases(100 bases per row)
TGCCGTAGTTGGAGGTCTTCAACGTTTCATATCACTTCACTGTTCATCGGTGAGTGATGAGACCTATCGATAGATTTTTGTTAAATCGTGGAACTAACTC
TTTTTTGGTTTCGTGATCTATTGGCTTTGACGCTGCAGGCAATTGCTTAGCCACAGTCGCCCCAAACCCCTCGGAGCTTCATTGGCGCACAGCAGAATCC
TTTTTTCTTCACGCTGCCGGTGCTCGGTTGCCTTAGCTGCTGCTTTCGAGCAAAGCGAGCGCAACAGGAGCTCAGGGACATCACCAGGCTCGGGATAGTG
GGACGTCACTCAACCGGGACATTGCTGATGAGGACGCCGATGTGGACATGCTGCTGGATCAGACGCTGTACGAACTCATTCGTTGGCTAGTGGCTTGAGC
ACCGCAGATGGAGCACCTGCAGCACGACAAGGCAAAGCACAGAGCCCTTGATGAGCGGCAGCGGTATCCGATAATTTGAACGATACAATGCTTTGGACTC
AGAAGTGTAGATACTTTAGACGAAGAAGTTTCCGGGTCAAGGTGCGAGACTGCTGTTCTTCTGCGGGCGATGGCCGCAGAAGAAGCAGTCCTTGCGTAAA
TCAAGAACTGCGGCAACTTTAGTGAGTGCATTCATCGAGGTCACAAGAGCATCGTAACGACGTCGAGATTAGTTTGATCATTTCGACAGAACAAGTTCAG
CGCGTACTGTGCTATTTCGGAGTCGGAGCCGTTAAGTAATTAGTTAGTGGTGTTGGGCAGCGCAGGAAGAAACCAGCACTACGTTACGTGCTTTGCTAAG
AAGGATACTGATTATCTGCCCATTTGCTCTTGTCAACAACAGACTTCCATTGTAATTGTTTCTCGCTCGACCATTGTGCGATCATACTTACTGTAAAGTC
TAAAATGTGGCTTGCTAAGCATTTTATTCAATCCACGGCTTGATATTATTTGTGAGCGAACTACCAAGCTACCCCAGCCTACGCAAAGCTCTAGTACACT
CCCATGATCCGTGAAAAAAAGCGGACAACAGATAAAGTGGGGTTGAGATCGTCGCATTACATAGTGCGTTTTTACTCAAATTTGGACTTGTTGATTGATT
CATTTCGAGAAGCAAACTAGGCCTTTATTTGTTGTGCGTTGACGACTTCAAGGCGTAAAGTAGCTCAGCAATCTGAATACGGCAACCTGAAGCAGCTATT
TTAGCTGCAAATGCCATGGATTTCTTAAGATCGAGTTGGTTTTCCGAGCTAACCACAAGCAGCAAAGCATCGTTTGTGACCTCTTTTGCCGCCGCTAAAC
TTCCGCTTCAGGGTTGCATAAAGCCGGAAAGTTAGACTGTGGAGCCGAACTAATTCAACACAGCCACAAATCCATTGGGCGCAGCACCAATGAGCGCTTC
GCAGGCCTTCGGCTCG