Description :
From Genome Similarity Track
Location :
Scaffold_13:8600- 9700
Transcript NameFunction/comments
Phymu_g939hypothetical protein PHYSODRAFT_540712

Sequence
1100 bases(100 bases per row)
CCCCCCGAGACGAAGTAATACTGGCTGCGGATCAACACTgtgagctcttcttcaatctgTAGCAGTCGGGCCTCCAAGTCAATATCGTTCGCGTCCAGTC
CAAATGGACACTCGATCTCCATTGCAACTTCATCGGCCATGAAAAGGAAAGTGCCCCACATGAAAACCCACAACGGAGTGTACAGCCCGGATCTTGGCAC
GATCACGAATGTGTAGAGCAGCATGTAGCCTAcgagcaggaactggagaTACTGCATGTAGTTGAAGGGGATTGGCACGTTGGCGATGTTGAATACCGTC
GTGTACAGGTTTGGCAGTCTAGCAATTTTGATCTGCATGTTATTGGCATTGGGAGGTGTCAAGTGGCCACGATTTGTGGCAACTTGCACCAGTCTTTTGA
GCCAAAGTTCCGTAATTGTGGCACGCAATTTGTGCGGAGTGCGACGAACAATTGCCCGGTACGATTCCTTGTCCTCCACTTGCATCTTGTGCTCGGATCC
ACACGCGTACAGCTCATCGTATTCAGCATCAGTCAATACACCAGCTTCCTTCAGTTTGTCCATCCCATCGAGACCCCGACAGTCATGAAAGACAATGGCA
ATGTACAGGAACACCAGACGACGAAGTTCCGTGAAGAATGTGCACTTCTCGAGGACATCTTGGGGGATTGTCGCCACCGCTTGACCGAGTTTTGATGACT
TATCAGTTGCTGGCTCTGGACAATTGGAAGCTTCCGCCTCAGTGAGCTCTCGTTTGATGGTGGTGCTTACGTACGCACAGCCAGAGCCCACAATATCCCG
TGCTGCCTCCGAAAGGGAACCGACAGCTACCACACCCGCTCGCCACTGGGTGAACGCTGAGTTCATGCGGAACGATACGATGAGACCCAGAAAAGTGTTA
AACACAGTGAGCGAGTCTGTAAAAGCGGTCGAGTCTCTAGTCGGAACAACAAACGGGTGGTAGCGGTTCACGACGGCAACAACGAGAGCTATCAAGGCCA
TAATGAAAGCTCGCACGGGGGCTTGGCCGTTCAATGCGGAGCCGTGCCACCGCATCAGCACTCCCCACAGGTGGTTCGTGTCGTAGTAGATCATCTtggt