Description :
From Genome Similarity Track
Location :
Scaffold_1134:860- 2473
Sequence
1613 bases(100 bases per row)
CTTCCTCTGACGCTAAAGCTACGGCAGCCCCGCTGCACTTGGTAGCACTTGTAGTCAATCCCGCTCCTGAGTCGGTTGACTATATCCTCTGCGAGGATGG
AACACCCCGTGTTCGCGAATTTGCCCCCGGCGCAGCAGGACGCGCTTACTAAGCTTATGTCCTTGCTTGGCCCGGAGGGCGTGGCTCATCTTGGTCCAGA
GGCGGTCAATGCCAGGCTGGAATCGTTCTCCCGCTACGAGAACGCGCTCTTGGAGCATGTCAAAGAGAAGATGAGCGCCGCAACGGCGGGGGCGTCGATG
ACGCGTGAAGAGTCTATGAGACTGAAGCCGCTCATGGTGAGCGTAAAAACCTTCGAGGGGAAGGATGGAGAGAATCTCCTTCTCTGGACCCGTGAGGTCG
AGATGGCCATGGGATCGGCCCTGCTCCAGTCTGATCATCAGCGCGTGGCGCTGGCTATCTCCAGGCTTGGAGGTCGCGCTCGCGAATGGGCACTAACGTG
CGGCACGTCTGTTGACGCTGCATTTTCCACTTGGGATCAGCTGAAGCAACAGCTCTCGCGCGTGTTCGCGCCGCCTAATCAGGCGTACCGTATCCGGTCG
AAGTTCCTTGCTACCCGCCAGGGTAAGAAGGAGTTATTGGACTATGTTCAAGAGTTGAGAACTCTTATCGCCGGAATGGCGGCGGACCCTCTTCCGGAAC
TAATCAGCGTGGCCGTGTTCATGGAGGGACTTCGTGTGAGCGCAGCTCGAACGGAAGTGTTCCGTGTACACCCTAACTCTTTCGAGGAGGCGGTGAATGT
GGCATTAAATGCCGAGCACAACTTCAGGTCGGCTCGACCTGGTTGGAGCGCTAGTAGCGCAAGCTCTTCGAGCGGTCCAGAGCCGATGGACCTTAGCTAT
GCTGAAGATGAAGAAGCGGAGCTTCTTGCTGCGGAGCAGCGTGCCGGCATCCGCCGATGCTTTGTGTGCAATAGCACTAAGCACTTGAGGGCCTATTGCC
CTCTGCGCAAGAAGCGCGAGGCTACGGCGAGCCAATCCTCTAGGTCATCGTCGGGAAACAGCAACTCCCAGTAGGCGCGGGGTGGCCTACTGGGGAAAGA
CTGAGCTCTGTTGTGCCTCGAGGAGGTAGAGGGCAACGGGGCTCAGCCCCGAAGAGAGCTAAGCTCTCTTACGAGAAGAGTGTGTGCAAGCCGGGCTTAC
AGGTCGTTCAAGCAAACGTGAAGGGCTTTGCAAAGCCATGGAGAGCCTTGATTGACTCGGGAGCCTCGGGCAACAACGCCCGTCGCTCTACCCTGGAAGG
GGGTCAGTTGTATGCTGAGGCACTAGACGTGCCAACGAGAGATTTGATATATGTCCATCTCGCGCCAAGGACACTAGTAACTGTGTCGAAGGTCTCTGTC
GACCTTGGAGTGAAGTTTGAGAGCTTCGATAGCGTGGAACGCTGCTTGGTCTTAGGCCTGGACGCGAGATATGGCCTCATCCTTGGCATGGCATGGCCGG
AACGCCATGAGCCATGGATCCAATGGAAGTCGAAACGCTGGGTGCGTCGCACCTGCTCCTAGTGGAGCTTTGAGGAGTCATGAACCCACCTCTGCTAAAA
AGCAGAAGGGCTT