Description :
From Genome Similarity Track
Location :
Scaffold_3317:86- 2454
Sequence
2368 bases(100 bases per row)
GTCCAGATCGGACGAAGAGGCCCGGCGGTCCACCCGCAGGTGCAGGCTCGCGACCTCTCGCTCCACCAGGTCCAGGCGACCCGCAAGACGAGCGAGCTCG
CCCTGATTCCCGGCCTGGGCGGCAGCATTACCGCCAGTCCCAAGGCCAAGTGCAATCTCAAGCACGAGGAGACGTTGACGGAGGCGGTCAACCTCAGGGT
CCCGTGTCGGACCCGCAGTCGGAGCACTCGAACGAGAGTGGCTCTCGGGAGGCGCCGAGTACTCGTACTCGTACGAGGGCACCTCCGCCCCTGCTTGACC
GGAATGGAGAAGTCCACTTCCACGTGGAGCGGATCCTCCAGGAGCAACGGTGTCGCGGGAAGCGACAGCTCCTCGTGAAGTGGAGGGGTTATGCCCACTC
CGCGAACTCGTGGGAGCCGATTGAACGGCTCCTGATTGACTGCCCGAAGGCTGTCGCAATCTGGGAACAGAAGCGGCGGCAGCTTCATAAGTAGTCCGGG
GCTTCTTGCCCGAACGGGGTACGGATGATGAATACATACCGTACCCGCGCTCATCGTGAGCGCTAGAAGCCGCGCGCTTCAGGATGTCCCTTGGCAGCAT
ACGCTTGCTGATCAAGTGGGCAAACCTCACACGAAGATCACGCTGGTCCAGGATGTGGGTCAGCTGCTGATCTTCATGGAGTTCCCATAACTCCGTGGGC
GAGTACTTGAGAGTCTCCACCCACGCCCAGAACATGTCCTCACAAGAACTCCATGTGGGACAGTTCTCGGGCATAACCCAGGGGTATCCCCAAACAGGAT
AGAGACCACCCCGGGTCTCGGGCTTCTTACGACAAGTCGTGAAGTCCTTAAGGGGAATGCGGTGTGGCGCGAGAAGCACACACCGAGCAGCCTCCACGTT
GTCGACGAACAACTGTTCTTTCTGAACAAGGGCTCGTTCATAGATGCCCCTAGAAATGTGGCCGCCCACAAGGCCACGAGGAGCGACGAGAAGCTCTAAG
AAGAGGTCGGCCCCAGAGCTCTCCTCGGGAGGCCAATACCTTCTTGAGTTGATGGCAGTTCCCTGGCTGACGGGTGCCGCCACCGAACCCCCACGCACAC
GCTGGGCAGCTTGGAAATCCTCCTGCTGCTGGTCGAGGTCATTCGAGACCTCCCGGGGCTCAACAATGGCACCTTCCTCTTCCTCTTCTTCCTCCTTCTC
CTCCTCCTCATTAAAAGGAGCCGAAGAGACTCTGATAGGAGCGTCGAGTCTCCTTCTCCTCGCGGAGTGGAGACTTAGAGGCGGTACGCTTCTTTGAGGG
CTTGGCGCCTTCGGCTTTAGAGGCCTTAGCGCGCGCAAGACCCTCGGTAAGCGAGAGACGTTTGCGAGGATTCTCTTCCTCATCGCCACGGGCTTTGGGA
GCGCCTTAGCCTTGACGGCCGGGCTCTCAGAGCGCACAGAGGTCCTGGGACTGTGATCACCGTGATCACTAGCGGGCGACTGCACGCTGCCTTCTTTGTG
CTCACTGGGCACTGGGCTGTGCCCTCCCACAGAGCCCGCAGGAGCATCCTGAGTGCTCTCGGACTCGGCATCGTCTTCACTGCCCGAGTTGAACTCGCGT
TCTACGAACCGAGGGTTCGGACGGTTGTCTGAAGACGAGGGCGACGGACTGCGGCGCCTGCTTGCGCGCTTGTCCGCAGCCGCGTCACCCGAGGAACCGA
TCGCCTCGGAGGCCACCTGAGTAGCCTCCTTGAGTGCAGAACCTTTGCCATGAGGCTTAGTGCTCTTGGCCTGCGCCTTACCGGCTGCAGCCTTGGAGCG
TGTCTTAGCACCGCTCTTAGCAGTGCCGCGAGGCATGTTAACGGTCGAAGTGGAGACCTTGACGAAGAGCGCACAGGTTGCTGCTCGAGGCTCTAACTGT
GAAGTGAGCCTCCGCCGCGCTCGCGCGGCCAAGTCGATGGTTTTCGACTTTGAGAATGAGAGTTTGTGACGAACACCTCTTCATTCTGATTATTCGGTAA
ACCGAACCTAAGTTGGGGAGGATGTAACGGGGTACGTAGCCCTAAGTGTCCCCTGGTTACATGAAGTGTGACACTTCACACTTCAGGAGTATGACACGTC
ATACTCCGAGATATTTGGTACAAGGTACCAAGGTCGTTCAAAGCCAACCATTGGTTAAATGACATTGCATTTCTATAGGTAACTAACAGTTTGTATTAAA
CCCAAACTTAATCTACCTATAAATATACTCAGTTTACAATCTACCTTATTTGGGTCACTTCGCTCTCTTTAATAAAAGAGGGGACCTGTGAACTGCCGTT
CACTGAGAGTTTGTATACTCTCGGAAGATAACTTCCTCTTGCGCAAGGTGCTGTGTGACCCCGTCACA