Description :
From Genome Similarity Track
Location :
Scaffold_3953:86- 1588
Sequence
1502 bases(100 bases per row)
CGGCCAGGTGAAAGAGGGTCGCGGTGTTTGGATATAATGGTGGATCCGACGAAGACGGAAGATGAACAAGTCTGTTAGCATGAAGGCGGGAATCTACACG
CCGAAGATCTCGGGGACGGCCTGGCGGTAAACCCGGAGGCGCCACTGACCACAGAGGAGGTCACGATTGACGATATCCAAGTGGATCCAGGGGCAAACGA
GCCCGCGGAAGTGGATCGGTTACGTCAGAAAATCTGGGAAAGCCGACATCTGCTGATTGGTAAAGGTGATGCATTGCCGCCCGCCGCCCGCGGGGTCAAA
TGTGACATCGATGTCGGCGACGCGAAACCGATCGCTCAAAGGGTGCGGAAGGTGGCACCTCAGTTCCGAGAAAAACTATCAGATCTGATTAAGGGCCTGC
TGCAAGCCAAGATCATCAGTTTCTCGACATCCCCGTGGGCATCTCCGGTAATAATCATCATCAAGAAGAACAGAGTGGATATACGTCTGTGTATTGATTA
CCGGCTAGCTAACGACCTGACCCGACTGATGGTGTATCCAATGCCTCTAATTAATGAGCTATTGGAGGATTTGGATAAAGTACTCTGGTACTGTTCTCTA
GACATGGCCAGTGGTTTCTGGGGTGGTTACTATGACGGATCGAGCTCGCGCGATATCCGCATTCATCACACCGTTTGGACTGTTCGAGTGGAACCCGGAT
GCCGTTTGGATTGAAGAACGCACCCCAGATCTACCAACGCCTGAGCGATAACGCCCTCTATGGATTCACCCGAATACCGGAACCCGAAAAGGGTGGATCA
AGGGAAGATCACACGGAAGTGGATCCATTCGAAGCGGGGGAGCCAGGGGATCCTAAGACCCCGTCTGTGTTAGGACGCAGATCTTATATCGACGACATTC
TAATCCCGGCGGAATCGTGGCATAAGCTGTGCGAGAGAGTGACATCCCTACTGGAGGCGTGTACTAAGTGGAATCTCTCTATCAGTGTGGTGAAGAGCTA
TTGGGGGATGCGCAAGGTGGATTACTTAGGCCATCGAGTCTCCAAGGAAGGATAAGAGGCGAATCCTAAGGACCTGTCTTCGTTAGCCGACTTGTCCTTC
CCACAGTCGTTACGGGCGATGCAATCCTTCTTGGGCAGTTTGAATTACTACAGTCGGTTCATCGAGGATTACGCACTGTTCGCTGCAGTACTATATGAAT
TGAGAGAGGTAGATTTTGCTGCGATGACCACTCCAGCTGTCCGGATCAAAATCCAACAAGCTCTGGCCCTGGAGATGTCAGATCCACGAAGGGATCCAAG
TAGCCAGAAAAAGGCCTAAAACAGGAGCTGGATCCGCCCCGGGACCAAAAGAAAGAGGATCCGATCAGGATAGAGACGACGAACCAGAGTTCGGAAAAGG
CGGAACCTCGGTGGATCCGAGCTCAACACGCATTTGTAGAGCTGAGGAACAGGATCGCGACCGCACCTATCCTCCGTCATTTCGATCTGGAACGTCAACC
TA