Description :
From Genome Similarity Track
Location :
Scaffold_2856:86- 1424
Sequence
1338 bases(100 bases per row)
CAAATCTTCCTTCTCAGCAGGATGGTAGTTCATCTCAGGCCTCCTTGAAGCACCCGACCGAGGAACTGTACGCGGTGTAACTTGCCTTCATGTTCTTGCA
TTAGCGTAGTGCGTCAACGCCCATTCATTCGCAAAGAGCATGACGTGAACTTCTTTCGACCGATCGAAGTGCCTGAGGATGGGTGAATGTGAAACACTCG
TCTTCAATCTTTCGAAGGAATGACGTGCCACAGAAAGGCCACCTTCAACGACAAAGTCTTCATCCTTGAGCTGGTACAGCGCCGCACCATAGACCGCGAA
GTCTTGAATGAAGCGGCTGTAGTAATTAACCGCTCCAAGAAACGACTGCATGCCCTTCTTGCTCGTTGGAAACGAAAGCTCGGTGATGGCCGCAAGCTTC
TTGGGGTCAGCTCTGATACCTTCTGGCGAAATTTTATGCGACAGAAAGTCCACCTTGGGTTGGCAAAAGATGCTCTTGGTGAAGCTAATGCTGATCCGAC
ACTGTGCAAATCTTGCTAGCAATCGGTCCAGCGTCGCTAGGCAGCTGTCGAAATCCTCGCCACCGAAGCAAATGTCATCCACAAACGACCGTCGACCAAA
TACAGGTACCAGCGATGATTCGTCTGGCTCCCCGTTCGTAAACATGTCAGCGACGGGGCTGTTGACGAGTTGTAGTACAGGGTCGGTCTCTACCGGTGCT
TCGCGGTCTGCCGCGAACTTCGTTTGAAACGAACTCTCGGCGCTTGGCCCACGACGTTCCTTGGCCTGTTCTTCAGCTAAACGCATCCTCTCCGAGTATT
CAAACCAACCTCCTTTAGGTTGAACGAACCCCCAGAGTGCGTTGTCATTCATACGCTGGTAGATCATCGGCGCGATCTTTAACCCGAATGGCATGCGTAA
CCACTCGAAATGTCCGAGTGCGCAGACGAACGCCGACGCCTTACGCGCTCGCAAGGTCATCATGACCGCCCAGAAGCCGCTTGCAGCATCCAACGAGCAG
AACCACATGTAGTGTTCGAGATCTGTTAACAAGTCGTCGACTAGCGGCATTGCATACTCCATGATCGCGGTGATAGCATTCACCATCTTGTAATCAATGC
AGAGCCGGATGTCCAGCCCGTTCTTTTTCATCAGAATTACGATCGGGGATGCCTATGGACTATCTGAAAAAACGATCAGTCCAGCTCGCAGCAGAGCACG
CAGCAGCTCGTACAGCTTGCCGAGAAATCGTAGCGGCACGCGCCGGGCAAGCTGTTTAATTGGAGCGTGCCCCTGTGTGTCGATATCACATACCGTGCCG
TAGGCTGGCGGCGGTAGTGCGCTACCACTAGCAACCAG