Description :
From Genome Similarity Track
Location :
Scaffold_2448:86- 1289
Sequence
1203 bases(100 bases per row)
CCTTCTTTTTTCTCCTCCTTCATCCGAGGAAGCCGAAGAGACTTCTGATTAGGAGCGTCCGAGTCTCCTACTCCTCGCGGAAGTGGGAGACTTAGAGGGC
GGGTACGCTTCTTTTGAGAGCTTGGGCGCCTTCGGCTTTCGAGGCCTTAGCGCGCGCAAGACCCTCGGGCAAGCGAGAGACGTTTGCGAGGATTCTCGTC
CTCATCGCCACCGGCTTTGGGAGCGCCCTTAGCCTTAACGGCCGGACTCTCAGAGCGCACAGAGGTCCTGAGACTGTGATCACCGTGATCACTAGCGGGC
GACTGCACGCTGCCTTCTTTGTGCTCACTGGGCACTGGGCTGTGCCCTCCCTCAGAGCCCGCAGGGGCACCATGAGTGCTCTCGGACTCGGCATCGTCCT
CACTGCCCGAGTTGAGCTCACGTTCCACGAACCGAGGGTTCGGACGATTGTCTGAAGACGAGGGCGACGGACTGCGGCGCCTGCTTGCGCGCTTGTCCAC
AGCCGCGTCACCCGAGGATCCGATCGCCTCGGAGGCCACCTGAGTAGCCTCCTTGAGGGCAGAGCCTTTGCCGTGAGGCTTAGTGCTCTTGGCTTGCGCC
TTACCGGCAGCAGCCTTGGAGCGTGTCTTAAGCAACGCTCTTTGCAGTGCCACGAGTTATGTTAAGCGTGGAGATGAGAGAACTTGAAGAAAGAGCGCAC
AGGTTGTTGGCTCGAGACTCTAACCTTAAAGGGAGCCTCCCTCCGCGATACACGCGGCCCGAGTCGATGTCTCTCGCACTTGGAGAAGGAAGAATTTTTG
ACGAAACCTTTTTTTCCTTTTGGTTGGGTCGGTTAAACCGAACCTAAGTGGGGGAGGATGTAACGGGGTACGTAGCAACACTCTACCCTGGTTACATGAA
GTGTGACACTTCACACTTCAGGAGTATGACATGTCATACTCCGGGATATTTGGTACAAGGTACCAAGGTCATTCAAAACCAACCATTGGTTAAATGACAT
TGCATTTCTATAGGTAACTGATAGTTTGTATTAACCTCAAACTTAACCTACCAATAAATATACTCAGTTTACAATCTACCTTATTTAGGTCACTTCGCTC
TCTTTAATTAAAGAGGGGACCTGTGAACTGCCGTTCACTGAGAGTTTGTATACTCTCGGAAGATAACTTCCTCTAGCGCAAGGTGCTGTGTGACCCCGTC
ACA