Description :
From Genome Similarity Track
Location :
contig_32:85997- 87518
Transcript NameFunction/comments
g6161.t1hypothetical protein

Sequence
1521 bases(100 bases per row)
GCAATGCAACGACAGACGGACAGAAAAACACTGTCCGTCCCATCTCCACCCAGTTCCTGCGAACAAGTTCAACGCCACACACACCTTCGAGGCTATCGCC
GGGTCTGATTGTCGAGGAAATCCAATTCCGAGCATAAGCACTCGCCATCATGAAGATACTCAGGTCCGTAAGTAACGAAGTCTCCCCATCAGAGCTGGTG
CGCAGCAAGCACGCGGGCTCAGCAAAATCGTCTCAATGCACCGAATAACAGCTGCAAGGAGCTCAATAGAAGAGCACTTGCCCCCCGAGATGGAATTGTC
TTTGCATGCGTCTCGATTGTATTCCTTGCCGTCCTAGGCTATTGATACCGGTACTGTACACCACTGAGGGTGTCGCCGACAGAGGGGGCGAGTTGCCAGT
TGCGCACGACGGGTGAGATTAAAGCATGTGGTCCTCGCTGGGAGGGAGCAGGCACATGTATGTAGAGGGGGGGGGATACGGCATCCTATCCGATACCGGA
ACGGTATAGCGTGACAAATTCGAGTGCGGCCGTCGGGCACTTCACATCGACGCGACGGTCTCCCTGCCCCTTTCTGAACAAAGCCGGCGTGTGCTGTTCG
AAAGGATTTGGCTGACGAGCAAGCATGGAGAGCGGTGCTTTGGAAGCAAGAGAGCATGGAGCTCATTCAGCAATTTGCCGAGCCAAGCGAACGACGTTTG
CTTAATTGAAGTCCGCTTCCAATACAACCTCCCACCCGCAAGCATGCAGCTCGCTCGCATCATCGCGCATTGCGCTCGCCGCGGCGATTGTCGCCTCAAC
GGCGTCCACCGCTGACGCCTCCTGGGGCTTCATGACCCAGGACAACGCCAACGAGGTGAAGTCCAACAACATCGTCGAGGGTCTCCAGCTGGAGCGTAAC
CTCGGCGCCGGCGGCGGCCTCCGCGGCTCCCAGGCGCAGAACACGCCGAGCCAGGGTGACGACAACTACACTGGCCAGAACACCCCAAGCCAGGGCAACA
CCAACCAGGACGACAACAAGGACGAAGGTGACAACACCCAGCACGAGCAGAAGGAGAAGGAGGATGACAAGGAGAAGAAGGACGACAAGGAAAAGAAGGA
CGACAAGGACGACAAGGAGAAAAAACGAAGGACGACAAGGAGAAAGGACGACAAGGACGACAAGGAGAAGAGGAGGTGACCAGAGCAGAAGGAGGAGGTG
ACCACGAGCAGAAGGAGGAGGGTGACCACGAGCAGAAGGAGGAGGGTGACCACGAGCAGAAGGAGGAGGGCGACCACGAGCAGAAGGAGGAGGGCGACCA
CGAGCAGAACAACAGTCACCAGGACGATGACAAGAAGACGGAGACACCCGAAGTTCCCACTCAGGACACTCCTGACCAGGACACTCCTGACCAGGACACT
CCTGACCAGACACTCCTGACCAGGACACCCTGACCAGGATGCGCCCACACCTACACCGGAGACCCCGGTGCAGGAGGTGCCGCCTACCCCGGAGGTCCCG
ACGCAGGATGAGCCTACGCCG