Description :
From Genome Similarity Track
Location :
Scaffold_543:8598- 9774
Transcript NameFunction/comments
Phypl_g9279hypothetical protein

Sequence
1176 bases(100 bases per row)
TGGGTTGTACCATGGTTTGGAGCTCCAACGTGCATCGAATCTGTCCTGGCCCCACCGCTCCGATTTCTCTGATCATGGATCGAGCGAGTCCTGCGGCGCG
TCGGgctccatcgagctcgaACAGCCTTCTTGAGGTCACTCGTTCCACAATAAACCTCTACTCGCGTCGATTACTTTTAACTCCACTCCGGGTGCGCCAG
ACTGGAGGGTTTTATCCATCGCTCCAAAACGCCCGTAGAGATGGAGCACCTTGATAATCAAATCGGTTCACTCCGCAGACCTTTACGAGCTCCCGGAACC
AATTCGGGCCTCCGTAGCTAGAAGGAAGCACGTAACACGAAGCGACAACGCCACCCTCACATCTGAGTCCGCCGTGATAACAACTTCAGCTCTAACAACA
ATACATCGCGTGGTTCCCAGTCACTTTAACCTGGACGTAATGTGGTTTTGTACTTACTGAAGGATGCGCTCTGGGCCGTGTATAGCTGGCTTCAGATGCA
CCATCTTAAGCCGGTTTGGTGAGCGTTTGAAAATAGTTATGCACGTTGAGTGTGATCTGAAAACTAGTAAATGAAGGTTGCAGTTATGCTTTGTTTTTAC
TTTTACGTGCTAAAACACGTAGACAAAACACCGTTTCGTATAAATCAGTTTTAGCCAATCCCAGGATTTTCACTTTTACCGTTGCCATTGGTTAGAATTC
GCACTCTCAACAATGCCACGTCAAAAATCGAAAATACCGCTCGGCAATGTCCACCATCCAGCGGCCGTGGATCAAGCGCTGGCTGTTCCTGAAGCCCTGG
TGCGTGGCGCTGAAGGGCCAGGTCGACGACTCCGTCCTCGCTTGCGAGCAGAACGGGTGGGATatccagcgtcgccaccttcaAGTGGCACTCCTGACAC
GAGGTGACCGAGTCCCACGAGGCGAACAGGGAGCGGGAAGTCTAAAATTCCCCACCGAAGATAAATTTCAAGAAACTTTCCAAAGGCGCGAGAAGCGCTC
TTGCTATTGGGTGCCGTGTTCCACGTCGACCGATGGGCTGTGAAATATATGCTTGGCAATTATTGTGACGTGGAGATGGgcgaggaaggagaagaaaTGT
CCGAAGAGGACAACGAGCCGAGattcgtgctcttcttggaCGTGGAAGGAAGAGGAAATGGGGGAAAATTTGATTC