Description :
From Genome Similarity Track
Location :
Scaffold_193:85966- 88216
Sequence
2250 bases(100 bases per row)
GAACAAGTCGATACATGAAAATAGTTCTTCGACAAGCGAGCCAAGGAGGGACATGTACATGAAATCAAGTCGCCTCATTGCAGCCCGATCTTTTGTGCGC
GTAAGGCAAAAGGTGGTTGGCGTGTAGTTCATGCTTACAATAAGTTAACAACAGCCATACCTGCGGAAACGCCGATCCTGCGGAAAGATGTCCTATTGAA
TTTAATGGAGAAGTCAACTTTCATTTCCTAATTGAATTTGAAGAATGCTCCTATCAGGTACTCATGAATGAGACCGATTTAGCCCAGACGGCAGTTAGCA
CCCGAAGTGGTATGCTGTGGGAGTGCCTGGCGATGCCATTAGGGTTGAAAAGGCACCAACGGCATTCAACCGAGTGGTCGCTCATGTGATGAGTTCACAC
TGTGCCTACACGCCCCATTAACCAGACATTGTGCTCGTTTATAGTAAGGCCAAGGACGAATGAAGTTAGATTGAAGCGCACAAACGTCATTTAGACGTTT
TGTTGCAGACTCTGGGTGACGCCCAACTTTACGTTAACTTATAAGAATGCGTCATAGGGGTCCCCAAAATACCTGTACTGGGATGCACCGTGGGAAAATA
CGGTGTCCGAGCAGACTCAGAAAATGTTAAGGCTTTTAAGGAATGGCCAGCCCCACGACATGTGAATGATCTGCACTAATTCCTTTGGCTTGATAATTGC
ATAAATACAGCAAGAATTATGCGGAGCAAACCAAACCAATTTCTGACCTCTTAAAACTGATGCAGAGTGGCATTAGTCTAAGGCTCAAGTTGATGCTTTC
ACTTCATTGAAGCAATCAATTGTAGAGGCTTCGGTCTTGTCACTGCCAGAAGATACTAAGCATTTTAGTGATTTCTGTGATGCATGTAATTTCGCTATCA
GCATTGCACTTATGCAAAAAAAATGACGACGACATTGACCGTGGCATCTCGTGTAAGTCTCGAATTTTAAAGGCCGCGGAGAAGAATTACCCCGTGCGAG
ATAATGAGCTATTTCGTATAAATTATGCTCTTGTGAAGTTTCGTGTACCTATTGGGCACCGAACCTTTTATAGTTTACACGGATGACGCATCACTGCGAA
CCGCGATAAAATCGCCGCACCTATCACCTAGGATAGCGAGGTGGCTCACATTATTAAATAGTCGAGTTTAATACAAGCCGGGATAGTTGAATTGGCTGAC
GAGTTATCGCGCAGACCATACTTCAAAAAACGACATCATGAAGACGTGTCACTTGCTAAAGCACGAATTGAGTCGTCTACACCGGCAACCCTACGGGTTG
AACATTTGACAAACATTCTAGCCTTTGATTTAAAGTAGAGCTACATGCAGGACGAACACTGTCTTCTACTTTTAGATCACTTTGGTGGACATTAGGTAAC
TCTTCCGTCGCACCAAAAGTAAAAGCTTAACCGCTTTAGTAACACAGTGATGGCCTGTTATGGCATCAACTGTCACCTTGTGATCCATTGAGAATCTATT
TCCCACACGACATAGATCTCAAACAGAAGATTCTCTACGAGTTCCGTGATGCACCATCAAGTGGTCATCTGGTTCGTGAGAAGCCATTCTTACGATAGTC
AGATGAGATTCGGTGGCCATACCTATATCGGTGGGTATCCAATTATATACGATCATGCGAAGAGTGTGAGCGCGTAAATCTTGTACCTTCTAATAGTGTG
ACACTAAAGCCAATGCCGAGACTAACTGACTGTTGGACGTCGGTCAGTTTGGACTTCATGTTGGCATGCCGCCTAATCATAAAGGCAGGAATGGTATCGT
CGTCATTGTCTACATGCTGAACAAGATGGTGTATTTAGCACCATGTAGCACCAAGGTCTCAGGCAAGGAGGCAGCTTTCTTGTTCCTGGATCGTGTATTG
ACTACACGGGATGCCCGAGTCCATGCTTTTGGACCGCAATCCACGTTTTACGTCAGGATTCTGGCGCCATGTGTTTGAGCCGCTTGGTAGTAAGCTCCAC
ATGTCTACCGGCGATCATTCCCAAACCAATGGCCAAATCAAACGGATTTATCGTGTTGTGGATCTATTGCGCACAGATCGCAACTCCCAAGAAATGGAGC
AAACACAGGCCGCTCGTTCAGTATTTTCTCAACAAAAGTGTTCACACCAGTAAGGGTGGAACACCTTTTTATGTCAACAGACTGCATCAACCTCTCACGC
TAGTCTCTTTTGTGCGCAGCCCGAGTCTTAGTGGGGGAAGTCCCCTTAAT