Description :
From Genome Similarity Track
Location :
Scaffold_145:85960- 87048
Transcript NameFunction/comments
Aphin_H310_10798cathepsin B, cysteine protease family C01A, putative

Sequence
1088 bases(100 bases per row)
TGTTGTAGCGGCGGCGGTCGTCGTCGTTGCGCTGTGTACCGCCCATGACAGCCGAACGTGCCATCGGACGTGGAAAGGACGAGAGCACTTGCACCCGAAT
GTCCACAAACTGCCGCCGCCAACCGACGACGAATTGGACGAAATGAAATCATTGCCTCGACACTTGGACTGGTGCGAGCGGGGCATGTGCACACCGTCGT
GGAACCAACATATTCCTGTGTACTGCGGGTCATGTTTTGCGCACGGGGCGCTGGCCTCGGTGAACGACCGCATCAAGATCTTACACCACACACTCGGATG
GAAGCGACCTGACGTGATGATGGGCCGGCAAAGTTTTCTCAATTGCGCTCCGGGGCATGGCTTATCGCATGGCTGCAAGGGCGGCGAGCCCGCCGACGTG
TACGAGTTTATGCGTTTGTATGGCCTTCCCGACGAAACCTGTTTACATTACAATGCCACGGACCACACCAAGTACATCACGTCGTCAAACCCGAACGGCA
CGTGCCCCCCGGAAGGCTATTGCATCGAGTACCGACCCCAACGCAAGCGTCGATTGCATGGCGCTGACGTCTGTCTTGTAGCTGCATGAAGACACCCGAC
AGCCCCGACACGCCGGTGTGCTTTCCAGTGACTCAAACGATTCGATATCGTGCCAAGGAGTATTGGCGCCTCTCTGGCGAACATGCGATGATGAAGGAGC
TCCAGCACGGTCCCATTACGTGTGGCATGGCGTGTTCTAACGAGTTTGTGTTCAACTACACTGCGGGCATTTTTCGCGACACGACCAACTTTACTGAGTT
GGATCACGATGTCGAGATTGTGGGTTATGGCGAAGACTCGCACGGTGTCAAGTACTGGCACGTGCGCAATTCGTGGGGCACGTACGTGTGGTCTTTTTGT
TTGTGTGGTTCGCATTAACGGGAGCTGGTGGCACTAGCTACTGGGGCGAGCATGGCTTTTTCAAGATCGTGCGCGGGGAAAACAACTTGGTCATTGAGAG
CGACTGCCATGCCATGGTACCAGACGTGGCGGACGATGTGTTTGTGTGGGACAAGGTGCGACCTGCCTACGGTGGCTCGATCTATGGC