Description :
From Genome Similarity Track
Location :
Scaffold_51:85929- 111003
Sequence
25074 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCAAGCCAATT
GCCCGTGGATCCCAGTTGCTACAGATACCCACTGCCTGGGAACGACGACGCGACCGTAGATCCAGATCCTGAGACGCCGATCCCGAACTTTGATACACCG
ACGGATACAGCCTTTGACAGTCGATCCGGACTTGGATGCCGTGGATCCCGTTTTGGATGAAAGCAACGGATCCAGTCTTGAGTCCAACTCCCGCTTTGGA
CGTAGCTACGGATCCAGTCTTGGACGCCGTAGATCCAGTCTTGAGTCCAGATCCAGATTTTGACGCAGCAGCAGTGGATCCAGCCTTGGCTCCCACTCCC
GCTTTGGACGTAGCTACAGATTCAGTCTTAGACACTGATGCCGACTTGGATGTTGTGGTGGATCTGGACTTGGATCCGGAACCAGACTTCGAGGGGGAGG
CGGAAGGCTTGGACGTGGATGTGGATCCCACCTTGGACGTGGATGTGGACCCCGCCTGAGAGGCCGCCTTAGAGGCCGAACTGTTTTTGGGCTTGGCCTT
TGGGGAAGCTCGGGCATGCTTGTGAGGACGGGGGGGGATCCAGTGCTAGGAGCGGGAGATGCACTACGCGGTCGTTTCGCAGCCGACGGATCCGCCCCAC
TTACAGACGGTAGAGAAGCAGAAACGCTGGCAGCAGGAGAGGGCCCAGACAGGAGAGGAACGGGATCCGAGACAGCAGCTGTCACCAGCGCCAGTCGTCG
ACGTGCCAAATCCCGCTCCGATAGGCCACGATCGCGCTCCAGAACTAGCTGCTGGTGCTGAACATGAGCTGCAGCGAGTAGATCCCGGAGTTTTGCTGCG
GTTGACTCAGCATCCTTCAATTTGTCACCTGGATCGACATAACAGGTGAATATGGGGTTACTAGCGGGGGATAAAACAGGATCCACGTACTCGTGCGGCG
GAGCTTGGATTTCAGCTCCGTTTGCGTTCGCTTGGCATCCGCCCACTCGGTAGCCGCCTTGTCCTGCTGGAGCTCGGTGTCCGCCAACTTCGCTTGGATC
TCGTCGCGCAATTGAGTTACGCGTACGAATTCTTCGAGCGCGTAATCCCGCCCGGCAGACGCTTTCTCGAGTGACTCCTTGGTATCTTTCAGCTCCTCAG
AGAGACGAGCCAGAGCTGCATCCGGCGACGAGGGAGGTGGATTTGGCGCGGGGGACCCTCCACGCGCCGACCCTAATGCGGATCCGCCATGGGTGGATCC
CACATAGTCGTTAGTCACCACCCCTTCTTGAGTCAGGCGCTACTCGTCACGGAGTCGATCCAAGCTCTCGTCCGCGGCTGCACTAGCCGTCTGGGAATCC
TCCAGATCCCGCTCGAGGTCATGGATCCGGGATTGGAGCTGGTGGATCTCAGATCCGGCGAGCGCCATCTCCCTAAGGAGGTGGTCGTTGTCGTCCCGCA
TGCCGTCTCGCTGACGGGAGGCGCGATCCAGCCGTCCGCTCAAGTCGCGGATCTCGACCGCTTGATCGGCCAACAAGACTCGTAGGTCCTGCGAACGAGA
GGCCGCACGGTGCTCCCATCCCTGGATCTCCATAGTCTGGTCATGGACCTGGGCTCGCAAGGTTTGGAGTTGGGTGGCGTGCAAAGACGCAGCTTGGTCT
CGGGCATCTTAATCCGTCTGGAGCTCCGCCGTCAAGGTTTGCACCCGATCGGGAAAGAGCCTGGGCTAGCGTACACAGATCAGTGGGTGACATTGAAGAA
GGGCTGACCGGAGGAGTGGTGCTCTCTCCTCTTGCCACGCGATTTGCTGCGGATTCTTGGATGTGGACAAGTGTAAAGTAATCGTATGAGGGGGGGGGAG
GAGTAGATGGTGTTTGAACATCATGAATATTGAATTCTCACTCCAAAATATTATTATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNACTCGACGAGAGACCCAACAGAACCCTAAGACAACACTACGTGGCTATCGCAGCGACCGACGACGAGAAAGAGGAT
GATGAGGACGACAGTAAGACCGATATCTTTGAGCGGCGTGGGACAGATCTGGAGTTGACAGACTACGCTCACGAGTTGGCTTTCCTTCCCGACCTCACTG
AAGTTGAGTCTACAGAACTCGACTATGGTGCTCCAAACGTCAAGTCAGGTAGTCACACGCCAGCACAGTCGACTAGGTTGGTGGCAAAGCTGAAAAGCAC
GAAGGAAGAATGATTTCAAGTGGTAATGCCCTGCTGCCTCCAGCATACGGAGCATTGTGCGACGTTGACGTTCAAGGACACGCACCTATCAAGCAGAATG
CTCGGCGGATACCTCTCCGACACTTGAGCAAACTGTACGAGTTGCTTAAAGGGCTGCTTCGAGCTGGGTTGATATCATTCTCGGGCATCCCTTGGGCCTC
ACCAGTGGTGATAGTGCTCAAGAAAAATGGTGGGGATATTCAGCTGTGCATTGACTATAAACTAGTTAATGCGATTACGATGCCAATGGAATACGCTATG
CCATTAGTCGATGACCTGCTCACCGAATTGAAGCGTTACCTGTAGTTTTGTGGTGGATTAGCCATGACGAGCAACACCCCGTATGAAATGACGATGGATC
TGGTATGAGTGATGTACGGGAAGGCAAGATCCACCAAGACCTATCTCGGATCCACCCTTACCTGGATTCACTTAGGTGGACATGGGATATACTATATACG
GGTGGATCGAGTGTGGATCCTATTAAGGAATGATGGTAGGTGTCATCTGAAGGTGGATCTAGTAACCACGGCTAACGAGAAGTCAAGATCCACCGCGAGG
TGTCCCGGATCCCATACTTCCGAGTTCGGATCCAAGGAGGGAGGATCCCGCATAGAACGACCTGGATCCAGGATGCTGGGATGATGGATACAGTGGATCT
CGAACTTTCGTGGGACAATGGAGATCACAGACGGTTGCAAGATGATGTTGGATGATTGGAGAGCTCAGATCCATGAAGAGTGTACACTTCAGTGAAGTGA
GTCCAAGCAACCCGGATCCAGATGAGTGTACCCATAATAGGGTGACCATATTGATTACGCCATGGATCCGGTGGATCTGAAGTTAATACAGCTGGGATGA
TGGGTCACGGAGAGAAAGGACATGCAGTCGATCCTGGTAAGGAATTTAACAAGTAAAAGACATAGAAGGTAGAGATCCAGGCAGGTATAGGCTTAAGTAT
CAATACAGACTACAATTTGCACAGTAACACGCAAGTGCCTTACTGCCCTCAAGAACCAGAACTACATTGGCCGTACGAGCTCGGAAAAGGTTGGGAATTG
CGAATCTAGTGTTGGTAGTGATAACTGGATAATACATTGGCCAGATCCTACAACCTAGTGAGCTTTTCCTTTACACGTGCAGATCCGAAGGGTTAACCGG
ATTAATGACTTGGCCGACTACACCCAAGAAGATCTCAGCTCTCAAGGTCCCGTCACAGGTGACGGCAAGTACGACGCAAAGGCAAGGAAACACACCTGCA
AGGCAGCCCTACGGCCAGATCCACGATCTAGGCCCTGGATCCATAAGCTCTAATATTCACTTAGGTTCCAGAACCAACCACGCAGAGTGAAGATTTTCCA
CTGCTGCTCCACCCCATCCCCACGTCTCGCCAAGACACTCAAGCTTCACCACTTGAACGCTTCGGAAGTTACCGAGAGAGCAAGATCCCGCCCTACCGAC
GGGTACACAAGGTGAGGAAAGTTCAGCAGAACACGGATCATCGGGGGACCCCCTCCGCTAGTCGGTGTCTGGGCGCAGTTGGTAAGTTGGATCCAGCAAT
CTCGCAGATTATACTATGGAGTAACCAAGATCACGAACTAGAGAACAAGTGGGCACGGAATCGTAACGGGATCATCAAGTGGAGAACAACTACGTGTGGC
GTTCCGACGGGGATTGGATTTGGCCTCGCAGAACAATCGTAGCTGAGATGAGCATTGGCCCGGACACGTTGCGTGTATACTTTGACCCTAGGGACTAAAT
CCATAAATAAAGTCTTCTATTTGCACAGTAACACGCAAGTGCCTTCCTGCCCTCAAGAATCGGAACTACATTGGCCGTACGAGCTCGGAGAAGGTTGGGA
ATTGCGACTCTAGTGTTGGTAGGGATAACTGGATAGTCCATTGGCCAGATCCTACAACCTAGTGAGCTTTTCCTTTACACGTGCAGATCCGACAGGATAA
CCGACTTTACTACTTGGTCGGTTACACCCTAGAAGGTCTCAACTCTCAAGATCCCGTCACATGAGGCGGCAAGTACGACGTAAAGGAAACGCAAAGGCAA
GGGACACACCCGGAAGGCAACCCTACGGCCAGATCCACGATCTAGGCCCTGGATCCATAAGCTCGAATAATCGCTTAGGATTCGGAACCATCCACGGACG
CAGATTGAAGATTTTCATCTGCTGCTCCACTCCGTCCCCACGTCTCGCCAAGACACTCAAGCTTCACCACTTGAACGCTTCGGAAGTTACCGAGAGAGCA
AGATCCCGCCCTACCGACGGGTACACAAGGTGAAGAAAGTTCAGCAGAACACGGATCGTCGGGGGACCCCCTTCCGTTAGTCGGTGTCTGGGCGCAGTTG
GTAAGTTGGATCCAGCAATCTCGCAGATTTTGCTGATCCCGCTACGCCACAAGATTATGACGATGGGACCGAGGGTTCTAAACCTTCGGTGGCGAGTGCA
AAGCATTCAGCACTGCTGAAGGCACCTCGCCCACCTATCAACGGTGATACACCAGCCGCCAAGCGCGTTTTCGACCGCGTACAAGCGCTGATGCAGAATG
ATGAGTGGATGCAGCTGTTCAAGCCCATCCCCAAGAAAAAAGCCGACTGGCCTGCGCTTGCGCAGAAACTTCAATACCCAGTCAACTCGGTTTCGACTAG
CCAAGTCGCCGAGGATTCAGTTTCGCTACTGTTTTCGCTGGGCTTCGAGAACGAGACGTACCCATCGACGATGTCGCTCCAAGATTGGAGTCCACATGAA
GCCGGAGCTGCTCTCCAAAAATGGAAGAAGAAGCTTCGGAAGGCGTTTGGCGCTGTTGGCATCAACGCCGGAAAGCAGCCTGTGAGTCGAACGATCGTTC
AAGATGAACACCCGTCCACGATTCCACTGCCGCCGACACCCCAACGACTCGTTCGTACTCCCCCGACCAAGCGTGGAGCTGAGCGTGGCGCCTTTGGCAC
TACCGAAGCTTCACCGCACCGTACTTTCAAGACTCGCACATGGTTACGCCACGTTCGGAGAGCCGTATGCAGCGTGTTTACGCTGGCAACGAGGGTTCGT
TCGGTCGCCGAGGTGGTCCGCGAGCTCCCAAAGGTGGTGCCGGACGTCGTCAAGTCGACAGCGATGGTTCGTCCAGTGACGATGACATTATGGTGCGTAC
ATTCGACGAGGAAGATCCTCAAGTCGAGTTGATGCGTCAGATGAATGAGCTGGCGACGCTGAACGACGTGGACCCGACACCGATGATTGAAATGGCATCG
CACCGACCGTTGGATCGCATCACGCCGTTCTCAGGCTCTCGCAACAAGAGCGAGAACTGTATGCAGTGGCTCCGTGGGTTCGTCTATGAAATGACTGGAA
CCCACACAGATGCCGACAAATGGTGCATTCCATTTGAGCTTAGTCTCCGGGACGGAGCCATTCATTGGTTCCGTCAACTTCCGAAGAAGACGAAGCGCAA
GTGGAAGTTGTTGAGCGACGCGTTCATCCGCTACTACTGCTCGCAGTTCACGCAGACGGCACTGTCACGTTACGACTCTGCAAAGCGGGAGCGTAATGAA
CATCTGTGCGACTACATAAACAGGCTAACGGCTACGCTCAGACCGCCCGTCTACACCTCGAGAAGAGTGGTCGCGACGCGAAAGAACACGTACAGCAGTT
CCTGGCAACATGCGATGATGACAAGCTGGCGGAGAGTCTCTACCACGCTCGAGTTGCCGACATTCATGAGCTCGAAGAGATCATTGAAGACGTTCTCAAG
GGCAAGGAAAGAATGGCCAAGCGCGACAGTGAGTATCGATACTCCAAGAATCGTGACGCGCGACGCGACGATGGGTACGCCCGCAACAATCGGCGTGATG
ACCGTCGCCGCGATGACAACCGCAACAAACCAAGGGTGACACTCATTGAAGCCACGGTGGACGACCTACTAGCTGAATTAGAAGGTCGTGAAGCTGCTCA
AGGGGGCAACGAGTATTCAAACGAAGATCCGACCGCTTACGACGATGTCCAAGATGAGTACAACGACTTTCAGCCCGATAATTCGGATGGTGATTTCTCA
TTGGATGAAAACGACCGATACCTCGCTGCTGCTAACGAAAATGAGCGCCGTGCAGCTGCTGAGGGCACCTACGCACGTTCAGACAACCGTCAACCGCGTG
GACACATGCCTGATCGCAAGAATGGCTTCAATCAAGATCGCCGAGGTGGTGACCGTGGGTTCAATCAGGACCAACGCGGTCGACGTGACTTCAACCGCGA
CAACCGACACCCACAGTACGGACCATGCGCGGTGTGCGGTGGCATGAGTCACTCCGCCCACTACTGTAACAAGCGATGCAAGTTCTGCAAACAACTTCAC
GATGCTGGACAATGCGAACTTTTCCGCAACTTCCAAGACCTTGCCAAGTTCGTGCGCACTAAAGGCACGAAGGAGGAACTCCCGCCAGAGCTCAAGGCCT
TCGTTCAAGAACGTCATTTAAACTAGGCAGCCCGCCAACTACAACTGGGTTGGTCCCTATCGGGCTGCCACAGTTAGCCGAACCTTCAATGGAAGCAGAG
TGTATCTTTGCTTTCATGGGGCAGAGTGAATGGCCTGATAAATACGTAACAAGTGTGAACGCGACGGAAAATGAAAGGGAGTGGAGTAGAATCCTCGGTG
GAGGTGTTGGAGAGAGAGTGGAGTGTGCTGATGCTGATGAGGGCACCAGCGAGGGTTCGCTCGGCTTGGTTTCGAGTGCAGCACGAGACGAGCCCAAGGG
TCACTCCAAGATGATGAAGTTGAACCCTGGCGAGAGACAGGGGTGGTGGTCGGCCAAGAAATTCGACCGACGGATCCGAATGAGAGCTCTGGTTCAAGGC
GCTGTGAACGACCAGCGAACGAGGATCCTCCTCGACACGGGAGCGAACGTTAGTGTGATCACTGACGCCTTTGCCAAGAAGTTGCGACTCCGAGATGTAG
CCCATCACGGACGTCGCATTGACATTCAAGGAATCAACGAAGGCAAGGTGTCTACGACGCGACGAGCGTGCGTCAAGATTACGCTTGGATGGGAGATGGT
GTACGAGTTCGAGATGTGGGTAATGGCGCATAGTGCAGGCGTCGACGTGGTGCTCGGGACCGACTTTATGATCCCAGCTGGGATCCGGTTGGACTTGTTT
CACGGCGCGGCGCAATTACCGCACGAAGTTCAAATCCCACTGATCCAGACCAAGATAATGATCGCCAGCGAAGCGTACGGCTCCCATGTTAACGCCGGGC
CACCCGAGCGTTTGGACATTCAAGCGTACGAGTGGCGAGAATATCGACTAGCGAAAGCGCCAAGTCGGGCTAGAAGAACACGTACTGTGGGTTCGTCGAA
CGAACAAGTTAATCCCGTCAGTAACGAGGTTTCGACGTGGACGGCCTCAGAGCATTCGGTTGACCAACGTGTCTGATCGAACTGTGTACCTACCAGCACA
CGACTCGATCGCGATGTGGACTTCAGATTGGGATTTGCCACGAAGTGACGGCTATGTGCGTTTGGATTCTAAGAAGTACCAAGATTGGCAAGTGTTGGCC
TACGAAGGTTGCAGAGACCGCGAGCTCTTTCAGCGTGAATGTGAAATCTACGAGCAATGGCTTGCAACTCAGCCTTCGGCAGTTGAGCGACCGGACTACC
CAGAACCTAGTGAGGTGCTAGCACGGTCTCTAGAAGACTCGCCAGTGGACTCTAGTGATCGTCTGACGTGTGCAGAACGCTGGGCACTGATCATGGAGGA
ACGTGAACGAGTGGAGGCTTGTCTGGCGTCTGGTGTGACAGTCGGGGACTCGGCCGACGGTCAACCTTCCGAAGAACCTTTGGACACGTACACGCTAGCT
CAAGGCGGGGGCAATATTGCAAACGAAGCCTCGGTAGCGCGTACACACGAACTAATGACCCCGGTAAACGTTGTACATACGCCGACGAGTGTTCGTGTCA
AGTCTGGGGTGACCACGGATGCGATAAGTAACAGCACTGGATTAAATGGAGTCACCAGTTTTGACGAAGTTGTCCCGGCCTTGTGTGCCACCAAATCTGC
GAACAAGACATCGATGGTTGATCCTGAGGATGCAGGCATCGCGCTGAAGGTGTTGAGTACGGCACCGAGTGTTCATCGCGAGAATGGTGCGAATGCCGAA
CTGTCAAGACAACGGCCGATCGAGGCACTCGACAAAAGTCAACAGCTCAATATGGCGGTTGCCTGCGCATTCAATATTCCGAACAACGACTCGGCAGGTG
GCCCAGAGATGGGAAACCAGGATGGGAAGGAGATGGATCCAGTACCGACTGTTGAAATCAAAGCGAATGCCGATGTTGAGTCAAGAGAAGAATCCGTAGC
GACTTTGGACGGAACGTACATCTCGGTTGCTCGAGTATTAACAACCGAAGGAAATGAAGCAACGGAGAACGCAAGGAATGACTTCTACGAACACCCAGCT
AACAACATTGGCTTGGAAGACTACGCGAAGAAACTGGCATTCCTGCCGGACCTTACCGAAGAAATCAACATGACAATAGACTACGACGCACCCAATGTTG
CTGAACCCCAGCTGTCGACCGATTGCAGGGAACGTCTGGTCGCGACGCTGAAGAACCACGAGCACATCCTGATTACTAGTGGTAACGCACTGCCGCCGCC
AGCCTACGGCGCGGTATGCGATATTGACACACAGGGGCACCCCCCCAATTAAACGGCGTGCCCGGCGCGTGCCGCTACGCTTTCTCGGCAAAATGTACGA
GCTGCTGCGCGCTTTGCTGCGAGCAGGACTGATCGTCTTTCCAGACAGTCCATGGGCAACGCCAATCGTGATTATGATGAAAAAGAACGGGCTGGACATC
CGGCTCTGCATTGATTACAAGATGGTGAATGCTATCACCGCAATCATGGAGTATGCAATGCCGCTGTGGTGAAGTGCTTTTTCAGAAATAAGAGAATGGG
CCTGACGCGGGGTCACTATCCCGAATCAGTGACAATTTCAAGTGATTAGAGAGGATTTGGGTTGGCTGGCACGGATACAAGTTGCCTGTGGTGGATTAGC
CATGGCGAGCAGCACCCCGTATGGAATGACGATGGATCTGATATGAGCGACGTACGAGAAGGCAAGATCCACCAAGACTTACCTCGGATCCACCCTTACC
TGGATTCACTAAGATGGATATGGGATATACTATACAAGAGTGGATCGAGTGTGGATCCTATGAAGGAAGGATGGTCGGTGCCCTCTGAAGGTGGATCTAG
TAGCCACGGCTAATGAAGAGTCAAGATCCACCGCGAGGTACCCCGGATCCCATACGTCCGAGTTCGGATCCAAGGAGGGAGGATCCCGCCTGGAGGGACC
TGGATCCAGGGTATAGGGATGATGGATACAGTGGATCTCGAACTTTCGTGGGAAAATGGAGATCACAGACGGTTGCGAGATGATGTTGGATGATGGGAGA
GATCAGATCGACGACGAGTGCAAACTTACAGTGAAGTGGATCCAAGCGACCTGGATCCGGATGAGTGTACCCATAATAGGGTGACCATGATGATTACGTC
ATGGATCCGGTGGATCTGAAGATAATACAGCTGGGATGATGGGTCAAGGGAAGAAGGGACATGCAGCCGAGCCTGGTAAGCGATTTAGAAGATGAAAGAC
ATAGAAGGTAGAAATCCAGGCAGGTATAGGCTTAAATATCAATACAGACTCCAATTTGCACAGTGACACGCAAGTGCCTTCCTGCCCTCAAGAACCGGAA
CTACATTGGCCGTACGAGCTCCGAGAAGGTTGGGAATTGCGAATCTAGTGTTGGTAGTGATAACTGGATAATACATTGGCCAGATCCTACAACCTAGTGA
GCTTTTCCTTTACTTGTGCAGATCCGACAGGTTAACCGAATTTACTACTTGGTCGGTTACACCCTAGGGGCTCTCAACTTTCAAGATCCCGTCACATGAG
GCGGCAAGTACGACGTAAAGGAACTACAAAGGCAAGGGACACACCCGCAAGGCAGCCCTACGGCCAGATCCACGATCTAGGCCCCGGATCCATAAGCTCG
AATAATCGCTTAGGATTCGGAACCATCCACGAACGCAGATTGAAGATTTTCCACTGCTGCTCCACCCCATCCCCACGTCTCGCCAAGACACTCAAGCTTC
ACCACTTGAACTCTTCGGAAGTTACCGAGAGAGCAGATCCCGCCCTACCGACGGGTACACAAGGTGAGGAAAGTTCAGCAGAACACGGATCATCGGGGGG
GCCCCCTCCGTTAGTCGGTGTCTGGGCGCAGTTGGTAAGTTGGATCCAGCAATCTTGCAGATTTTGCTGATCCCGCTACACCACAATGGTGCGCGTGCCC
GGATCTTTTGGTGACTCGGGATTTCACCGTAAGTCCCAAGAAGATGCTCAAGTGAAGATTGAGCCAGGGGAAGAGGCGTCGTCGGAGGTCGGATCGACGA
AGACGCTGCTGAATGAAACAAGATCCGCGGATCGATGGAGTTTTGGGAGGAACTCTGTCGACGGAAGAGAGGTGGATCCGGATCCGGATCTAGAAGAGAA
ACCTCTCTATCCTCCCCAGGTCCCCTCGGGGACCCCTGCGGATCTTGACGCAAGTCAAGATCCGCTAACAAAACAAGGGAAAGTGAAGGCGAAACGGTAT
GCATTTGCAGATTCACCGGTTAAGCCAACATCGTACCTAAACCCAAGCCCGCTAGTCGAAGAAACGATAAAGAAGACGAAAACGAGTAAGACTACGCGGA
AGAAGATGCAAGCCCCAGAGTCGGAAGAAGACCAAGCTGGATCCAGGTCAAGCTGGTCCGACAAGGATCTCGAGTTTGTGTATCGCCACCAAGCTTTACG
CGACTTCCTGCATCAAGATCCTGTCATGCAGATCCTGAATCCACGACAGATCGAAGATCCAAGGGAACCGGTGAGAGCACCAACGAAAACGGCGAACAAG
TTGGTGGCAGTCAAGGATCTATTACGTTTGCTTACGGAGTCAGGCATCGTAGCTGGTGTGTTCGACGCAGAGGATATCTTCGGGCTAGATCTGGATCTCA
TAGCATCCGCGACGCAGGACCTCTTTGCCAGAGTTAAGTCCATCACCGGAGAAAGGTCGCGCACTATGGATCCAGTGTCATCGCCGAGGATCAGCCAAGC
TGCGTCCTCGAACTACGAATCCGCCGCTGAGGATGAGTCAGACACGTCGTCCGAACCACGACGCATGACTTTAGGACCCTCCGGGGCATCCATGCTGGAA
GCGCGGGCGAGGGTCCGAAGACAGGAAGCCCCTGTGAACGTGAAGGCTCGGGATCCAGTAGGCCCTACGCGTGATCTGACACAATCCATCCAGGATCGAG
CCAGATCCGGCAAGAAGCCAGTGGGATTATCGTCAGATCAGGCTCGAGGTAATCGCCTCACGGACCCTGTCTCGCCAGTGGACCAGACGGCCGCAGGCTC
TTCCGACACGTCCTCGGGCACACTGCAGCGGCATTTCGAAGCTGCGATGAGTCGTTTCCTGGCCGAACAGGGTATGAGAGCGCCCGTGCCACAAGTGCAA
GTGCTCCACGAACATGGAGCACGAGACGTGGAAATGGAGTCAGTGGAGGCAGACAACTTCCATGATGAGTTCGACCCAGATGATCTGGATGGCCCATCCA
CTTCGTCAGCAGTGGTAGCAACAGCCACAGCCGGGGCAGGTGGATCGTCCATGATCCAGAGGGTACGGATCTCAGCCATATCGGACCTGAAGGAGTTCAC
GGGCAAGGATCAAGATGAGGACCGAGCGAGAACATGGATCAGCAAAGTCAAGTTGGCCCTCATGAGAGATCAAGCGTCGGATGCTGAGAAGTGTTTGACC
TTTGCGGATCTGCTAGCGGGGCCAGCCAGGAACTGGTATCGGCAGCTGGGCAGATTCACCAGGAACAAGTGGCCGGATTTGCTGCGCAGCTTCCAGACCC
AGTACTGTGGATTGGGAGTGTCGGTGGCACGACAATACTACCATGCTCGCCGCAGATCGGATGAATCCCCGCTGGAATACCTACATCGACTAAATGTGGC
CGGTCTACGGGCCAAGTTGAAGATCAAGGATGGGGGATCCAAGGTACTGCGGGAACACGTGGATCACTTCATCGAGACGTTGGGAGATGTGGATCTGGCC
GACAGGCTGACCCTGTTACGTCTTCCAGACGCAGATGAACTTGAAGAATTACTGCGGGCTGTGAATCGCGCGAAACACCGCCATAAGAAGGCGGTGGTCG
GATCCGGCAAGTATCGCCAAAAAAACTCCGACGCCCACGGCTCCAGATCGACGTGTCGACCAAGGCACGACGCCCGACTCAGGAACTGAATCGGGATCCG
ACAGTTCGGACTTCAACCCAGAGGATTACCGCCGAGTCTGTCCAACGATCGTGCTGCGAAGACCGAGGACAACTCTCGATCGGGGGATACCGTACCCGGG
GACCGTGGGATGTACAGATCCCGAGATCTCATGGACGGGACAGGGCAAATCAGGTGCTCGCAGTGCGGATCCCGGAAGCACACAGAATCTGGATGCTGGA
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNACAAAAGTCAACAACTCAATATGTCGGTGGCCCGCGCATTCAATATTGCTGAACAACGACTCGGCAGATGGCCCAG
AGATGGGAAACCAGGATGGGAAGGAGATGGACCCAGTACCGACTGTTGAAATCAAAGTGGATGCCGATGTTGAGTCAAGGGAAGAATCCGTAGCGACGTT
GGACGGAACGTACATCTCGGTTGCTCGAGTGTTAACGACCGAAGGAAATGAAGCAACGGAGGATACGAGAAATGATTTCTACGAACACCCAGTTAACAAC
ATTGGCTTGGAAGACTACGCGAAGGAGCTGGCATACCTGCCGGACCTGACCGAAGAGATCAACACGACAGTAGACTACACTGCGTCTAATGTTGCTGACC
CTCAGTTGTCGACTGATCGCCGAGAACGTCTGGTCGCGACGCTGAAGAACCACGAGCAGATCCTGATTGCTAGTGGTAACGCACTGCCGCCGCCAGCCTA
CGGCGCGGTATGCGATATCGACACACAGGGGCACGCCCCAATTAAACAGCGTGCCCGGCGCGTGCCGCTACGATTTCTCGGCAAACTGTGTGAGCTGCTG
CGCGCTTTATTGCGAGCAGGACTGATCGTCTTTTCAGATATTCCATGGACATCGCCGATCGTGATTGTGATGAAAAAGAACGGGCTGGACATCCGGCTCT
GTATTGATTACAAGACGGTGAATGCTATCACCGCGATCATGGAGTATGCAATGCCGCTAGTCGACGACCTGTTAACAGATCTTGAGCGCTACCTATGGTT
CTGCTCGCTGGATGCAGCAAGCGGCTTCGGGGCGGTCATGATGACCTTGCGAGCACGTAAAGTATCGGCGTTTGTCTGCGCGCTCGGACATTTCGAGTGG
TTACGCATGCCCTTCGGGTTAAAGAACGCGCCGATGATCTACCAACGTATGATTGACAACGCACTCCGGGGGTTCGTTCAACCTAAAGGAGGTTGGTTTG
AATACTCGGAGAAGATGCGTTTAGCTGAAGAATAGGCCAAGGAACGTCGTGGACCAAGCGCCGAAGGTTCGTTTCAAACGAAGTTCGCGGCAGACCGCGA
AGCACCGGTAGAGACCGACCCTGTACTACAACTCGTCAACAGCCCCGTCGCTGACATGTTTACGAACGGGGAGCCAGACGAATCATCGCTGGTACCTGTA
TTTGGTCGACGGTCGTTTGTGGATGACATTTGCTTCGGTGGCGAGGATTTCGACAGCTGCCTGGCGACGCTGGACCGATTGCTAGCAAGATTTGCACAGT
GTCGGATCAGCATTAGCTTCACCAAGAGCATCTTTTGCCAACCCAAGGTGGACTTTCTGTCGCATAAAATTTCGCCAGAAGGTATCAGAGCTGACCCCAA
GAAGCTTGCGGTCATCACCGAGCTTTCGTTTCCAACGAGTAAGAAGGGCATGCAGTCGTTTCTTGGAGCAGTTAATTACTACAGCCGCTTCATTCAAGAC
TTCGCGGTCTACGGTGCGGCGCTGTACCAGCTTAAGGATGAAGACTTTGACGTTGAAGGTGGCCTTTCTGTGGCACGTCGTTCCTTCGATAAATTGAAGG
CGGGTGTTTCACATTCACCCATTTTAAGGCACTTCGACCGGTCGAAGGAAGTTCATGTCATGCTCTTTGCGAATGAATGGGCGTTGAGCACTACGCTAAT
GCAAGAACACAAAGGCAAGCTACACCCCGTACGGTTCCTCGGTCGTGTGCTCAAGGAAGCCGAGATGAACTACCATCCTGCTGAGAAGGAAGTCTTGGCG
TTACTTCTGCTGTTGAAGATATGTTACGTCCAGCTGGCAGGAAAGACGCTACATGTCTATACACGATTCTCGACGTTAGAGTGGGTGCACAAGTCGAAAT
CTCTGTTCGGACGCGCGGTCCAGTTCGCTGTGCTGCTTTCGCAGTGGCATTTGAAGGTGCAGCGCGTGAAGGAGAAGGATGTCGCCTTCGCACAGCTCCA
GCAGTCAAGCAACACGAGCTTCGTCGACTTGGAAGACTTACTCGCGCCGGTGGCACCTCCAAACAAGGGCTCTCCGACTATTCGAATGGACCCCGCGTTG
CTGTACGCCAGGTTTCCCCGTAATTACAGCGGATTCGTCATGTCTTTTGACGGATCAGCGAAGACAGAGAAGTACGGCTACGGGAGTTGTTCATGGGTGT
TGTGGAGCCTTCCTGAGTGGAAGATAGTGATTGCTGCAAACGCTTACCTCTCGGCTACCACGGTGAATGAGGCAGAGTATACAGGTATGATAAACGGTGT
CAAGGCTGCTATTGCGCACGGTGCCGAGGATTTAGTCATCGTTGGTGACTCAAGGCTCGCGATTCAACAATCACTAGGGGTGATCGCATGAGGGAGGAAA
CTGCTAGCGCTGCTGAATACTCACGAGGAACTCGCGGCCAAGCTTCGATCAGTTAAATATCTTCACGTTGTACGAGAATACAACGCTGCCGCGGATTTAT
TAGCCACTGAAGCGCTGGAATCAAAGGTCAGTCGGGTCATCTTGGCTGAAACTCGCAAGTCGGAATTGGCGTCGCTGAATCGCATCCAGGAAATGATCTA
CGAGCCGGATGAAGACTCGGTAGATGTTTCGTCACGAGGAGCAGAGCATCAAGTACATGTACTGTCAGGCAGCGAGTCTTCAAAGTGGAAAAGTTTCGAA
AATATCGTGGTTGATTACAGCTCACCAGAGGGTGATTATGGTAATATGGCAGTGATGACTCGGCGACAGACGAAAGCCAAGAAACGCGTCTGGTTTGTAG
ATGAACACTCAAAGGAGGTCTCAAAAGCTCAAGAACAGCATGAATATCGACGAGAGACGTCCACCGATATTTCAATCGGCGAAGATTTGCCAGACCATCC
TCACAAGACTGTACCAGCGGCATTTCCCGATGCGGAAGATGTTGACCCGGTAGCAATACAGCGTGAACGCCGCAGACGGATAATGGTGGCACAAGACGAA
GAGCAGAAGTGGTCTAACATCATGAAGGTGCTTCTGGGCCAAGCAGAAGAGCTGAGTTATAAAGAAGCTCGAGATGCCTGGAAGTACGCTGACCTGTTCG
TGTTATCAGAAGACGGCGTGCTTCACTATCTTGGATTGAATCGTCGGTACGACCACGGTTGGCAAGAAGAGACCAAGCTGCGGCTTGTGGTACCGACAAC
GATGATTCAAGAGGTCTTGCAGAACTGTCACGACTCGCTGGATGGAGGACATCAAGGTGTGGTGAGAACGTTCCATCGCGTTAAGTTCGATTATTATTGG
ATCGGCTTGTACACTGACGTGGAGAAGCATGTGAAGACATGTCCAGATTGTAGCTCGAGTAAAAGCCGTCCGCAGCTTCGTGGATACTCACCTGGTAACG
TACTCGCCGAACGACCTTTCCAGATCGTCTCGATGGATTTTGTGATCCCACTACCGAAATCTCGTAGGGGCAACACGGCGTTGCTCCTATTTCAGTGCTC
GTTCACGGGATTCGTTATTGCCAAGGCTATGTCGGATACAACGGCACTGAGTGTTGCCCAAGTGTTCGAAGAATGTGTGTACCGACGGTTCGGAGCCCCA
TCATTAAAAGGCATGACCGCGACCCACGCTTCATAAGCGAGGTGTTCCAAGCATTTGCAGAGATGATGCAGTCAAGGTCACGAGCGACTTTGAGCTATCG
GCCACAGGCTAATGGACAGCATGAACGCTCGGTGAAGTCGGTGATGGGTTCCGTACGGGTGTACGCGGAAGACCCTCTACAGCAAGATTGGGACGACATC
GCGGAGAAGCTAGTATTTGCTATTAATACTTCTCAAGACACTACGAGGAAGGAAACACCGTTCTACCTCGTTCACGGTTGGGATGCTCAGTCGACGTTGA
GGGCAATGTCGTCATCACTCAAATGAGGACTCGGCAAGCAGTCTGACGCACTGGACGGGCGGCGTGAGATCAATCGACAACATGAGGTCGCCCTCACTAT
GGCCAAAGATTATCAGGCTGTAGAAAAGGAGCGACGGGCTAAAAGCATAATGATGCCCTGAGTGGACTGAAAAAGCCGCTGTACCCCAACTAAGTGGAAA
CGAACACTCGGCAGACCCTCCAGCAGCTTCGGAAGAGATGGAAGATCCTGCAAGAGCCCCACCGAGATCTCTTT