Description :
From Genome Similarity Track
Location :
Scaffold_1058:8592- 14438
Transcript NameFunction/comments
Phypl_g12211hypothetical protein

Sequence
5846 bases(100 bases per row)
GTCCGGCGGCATTAGCGCGACCCCACCCAGAAGACAGCATGCATTGGGCACTTTAACAGGTCACAACATGGCCCCACAATAACCGCAGCGAGAGTTCTGT
TCAGGAAGGGGGTGACGCTGAACAGGTTCAAATTCATCCAGAGTGCACAAATCAGCACTCTGCCGAGTTCGGGGAGCGCGAAAAGGACAGCCCGACCGAT
CAACAGAAGGCAAGGCACGTAACGCTGCCGTCAGCTGAGCGTACGTGGACAATTCAACGCTTTTGTCTGCGTCTTCAGATCCCTCCGGGGTAAGGTTGCG
CAACGAGTCTGCAAGTTGACAGTATGTCGGATACCCTGGCGAAGGCTCATCTTGTGATACCAGATGAGGCGAGAAGTTCCGCAGAACAGCGTTGAGTTGG
GCGTACATAGGGAATCCAGGGCTCGGTTCATCTTGGGAGGGTACGTCTGGGGTAAGGTCTCTCAACGCAGCCGCCAGCTGATCATACGTCGGAAAGCTCA
GAGCGATTTCTTCCTGAGGCAACGTGCCCGGGGAGAGGTTTCGCAGCGCAACGACAAGCTGACCGTAGGATGGAAACTAGTCGGATTGTGCATCTTGAGT
ATCATCGAAGAAAGTTTGAGAGCTGCCTGCTCGTCGATAGGAGAGACCTCTGTAGCCACAGTCATCGCGGGCAAACCAACTTGGGCCGTAATGTCCACGT
TCGCATCACCGGACCCGATAAGCGTAGAACCCCCGGGttccgctgcagcaagtggagcCTGCGGGCAACAGACCTTGTTTCCAAGTAAAGTACAGCGTGG
CGCCTGTTATTCTGACGGCGGACTCGCGCTTCAGCGTTCTCGTCTTGATCAGGTGTGCCGTACCGAAGCGATATAACGTGTCGCTCCGCTTGAGTCAGCT
CCACAACAGGTAGAGCACcgcaccgacagcagcagcgatctgGGCCTCGACTCTCCGCGCGACGTGGCGCTTTTGCAGACGCGAACGTGTTTGGGCGCGA
TTAGCCTTGTGACGGGCTTTCATGTGTCCACCTTCGTGCGCTGGCGGCGTAGCATACTTTGCCTCTAAGGCCTTCCACGCGTCTTGACTGCTCATTGCGT
TCTTCGGGGTAAATTGCAAACTGACAGCGACGAAACATGTTTCAACCAAAATCCAGCGCCCTGCACCAAACTTTGTAAGCTCGACACGACACAATGACGC
ACTGACATCACGGAGATGAACTGTCGTTAGGTTTACGTAAAGACGCAGTGTTTACAGCAAAAGTAATTTCCCAGATTTTAAAGTATAAAATAACGTATGA
GAGGAAAGTATGGAAAACCTCTGAGCAAGGTTTAGTTACTTCAACATGTCATGTTGTATTATTCACTCACTATCATATGTCAAGTCAATAACACTCTCCt
cgtcggccacctcggAATCGCTGAACGTGTCAATGAACCAAGGTTCTTCGAAACCGTCCTCGCCCTCACtctcatcttcatcttcatcagAGCCAAACAT
ATCACGCGTAGAGAGTTGACGGCGAAGTCTACGAATCATAGCCTACGCGGAGTTGAGTTCTTGTAGAAGTTGGTCGACTTCCTCCTCCATACTGCGATTC
AGTGTCGCAATGTTGTTGATCGTCTCCAGGAGCAAATCGGCGCTGGTACGCGGGAGTTTGGGCAGGCGCTCGTCGTCAGACTCAGAGTCGTACGTTCTTT
TCAAGATAACCACGTCAATAGACGTCGAAATGAAAAGTGAGAATCCCCCATTGCTGCAAAATATATTTGTACACTGTTATCTTTAACGGCACTTGTGTTG
AGGCCGGTTATGCTGTCAGCGGTGACTGGAATTAGTTGCACGTGAGGATTTCGTGTATAAAAATGAAAACGATGAGTGGATTGACACTGAGAGGCAGTTT
CATCATACGATCGGTAGGATTGGCAATACAATTGAGCGTAATCATTACGCGATATTGCAGTTTCAGCAAATTTACCCATGCAATTTCTGCTTCCGCCGAA
AAGATTTGGGTTCTGAGCCACGGACCTCCTGAAACTGCCAGCCGGACCAAACTCAGTTTCAACTGGGACAATCGTAGTGCATCCAGGTTCAATATTTGTT
GCGAAATGCGCGGGTAGTCACAAATACTGAGCCACAGTAGTCGCTTTTCACCGGCAGGTTAGAAATACATACCTATGTGGTCATATTTGAAATTAACGTA
TTTAGTGTGGTGCACGTAAGTGGTGGTGTGGTACACGTCGGCTGGTATAGGTGTGACACGCAACGGCTTCTATTCGTGTATTTCCGCATAAAAAGCCTGA
CATTTGTTATTCGCTGAAACtcatttcaaccaatcgAACACGCGAAAAAGCCCTACACAATCGGGACAGTCTACTAAAAAAAACTGGGTGCGGTACCCCA
TAGTTAAGGGGTCCGAAAATCCTCGAAAGGAGCTCTACGATTATATATCTGATGATTGAAATCCCCTACTACAATAAAGCCAACGCCAAAACCTGAAAAT
ACATATCGGTCCTTATGTACTTAGCAGCGTACTCGCATTTGCATATACTGGACAAGTGGTATGTCTAGCTTAACGACAAAGATTTATATATCCACGCGGA
GGTTAGCTGGCTGCGCTCTAATTATCATTGTGGCTAATAGGTCAAAGAACGCCGTTTTTCACAGTAACATTATGTAATGTAACAGTATATTCTAAAATAT
TGCGGTAGGACAAAGTGTTGCCGTTATTTTATAAAACACGTATGTGGTCTTCCAGCAAGCCATACACTACCCACCAAGTATATACGCACGCCCATGTATA
GGGGGTATAGCTTACTCGATATTGCGAGTTGGGCTCTGCTGTTCGGATATGTTGTTTATAGTCTTGAAACAAACCCCCGACATGTGTAAACGCTCCCGAT
ATAACAGTTTGAATAGGGGCTCACATACAACTGACCGATTTGGACCACGCGTCCTGTAATACGCACACACAAAAAGTAAGTTATCATGAATGATGATAAA
GACAGCTTTGACTGGCTCAGAGTCATTCGGGAAACGATGGGCTGAGGTCCACCGCTCACAGAGCGGGATAGAGGGGAGATTGGAGGACTGGACGAAGCTG
GTGTTGGCATTAGAGGAATTGAGCGGCAGGTCAAGCGCTCGACGGATGCTGTGCGGTGTGTCCTGAACGCAGACGACTCCCAGCCACGCAAGATGATGGG
ACCGCGTCCCAGTTTGTCCGAACGTGATGTTTGCCGTCTCGTTCGGACAGCATCGATTGGTAACTTTACGTGAGTGTGCGTATACACTTGGTGGGCAGTG
CAGCAAAAAATCTCCGACCTCCGACGGGCTCCGACCCGCGCAGATTTAGTCCTAAATAGTGTAAAGGTTGTGTATTTGATGTTAAGTGATGTTTGAGGTT
AGGTGATCTAAGTCAAGCTGTGTAGGGCCATGAGGGCATGCTAGAGAGCATGTTTCTAGGCGGCGCTATAAGCTCTGAAACGGCCTATGGGTCGAGAAAA
CGGCGAAAAACGATGCAGGCCGTTTTTCAGCCTAAGAGAGCCGCGGAGACATATGACTGCTTCGCGGTACATTGGCAAATGAGGCCGCACCCGAAAATAG
GGGTTCACTATTTGGAGAGCCTGGTCCTTTTTAGGATAGTTCTTACGCGTAAATACACCAGCTAGTGACTGGCTTGCACAGCAGACGTAGGTACAACCTC
AAAAAACAAGGTTTTATTGAAACGTCAGGCTTCTGGTTGCCGCAGATACATGAGCGGCCTCACTCTTCATTTTATTGTCGCAGCGGACAAGACGCCCGCT
CGCCCCCTTACCCAATGCCTCAGGCTGACTGTATATTTGTATGTCTACATGTTTGTGCCATATGCGGCCGCCTCTGCTGTTTGTGGGTGGTGTGCTAGCT
TGCATTGAGGTTAACATTGCTGTTCCGCAAGGAGGTTAAGCATTGTGTTCGATGCTGTATTCAAATTACATGTTCGCGTACTCTGTGGCGAGGTTAATTT
TGCTGTTCCATCCGGAGGTTAACCTTAGTGTTCACTACGGGGTTACCCATGCACCACTCACCTACTAAAGCTCGTAATACACCTGCGGTTTGCTCCGTAC
TCGATTGCTGCATATTGTTCAGTGTCGTTCAGCGAGTTGTCCTCCGCAACCTCGTCTTCGAAGAAGGTCTtgcggacaagaaggcggcgctcttcctcga
aggAAGCGACAAGCTTCTCGCTCAAGTGAACCTTTGGCTCCCAAATGGGCTGCCACTCGACCAGGTAGTACGCAACTCGTCGTTGAGCTTGTGACGTAGT
GCACCGGTTTGTCCTTGCGGTCATCGGCAGCGCTCTGCTCcgaggcgtcgtcgtccgcatAAGCAGAAGGTGCGAGCCACCCGCGTGCGTCTTTAAGGCC
GACCCTGCGCTTCTTCCGTTAGGCGAGCGGCGCGATGATAACGTCGGTCGCTTCGGGTAGAAGGCCTGCGGAGGCGACCGAAGTGTTCATCGTAAACTGC
TGGTGACAGATGACCCCATTACTCACGTGAATCTTGTGAATCTTGTGAATATTGCTAGCAGCAATGAACAGAGCCTTAAACTCATTCGCAGAGCTGACGG
CGTTCTTCGTTGGCCTCGGCGCGGATATGATGGCCGTGTTGTGCACGGTGGAGTCTCGAAAGCAAAGTGGAGAGTGGTAAGATAAGCATCAAGACAAGCG
CACATAGCAATGGAAGGCACGGACAACACGGAGGTAAAGTATGCGTAATTACGCAGCGGGTATTAACCCAACGAGGTATGTAGTATGCACATGTGCAGGG
TCAATAATGCGACCTGCCGCCTGAAGCTGCTTGTAGTGTCGGATAAGAGTGTTGAGATGGCCGGCCTTGTGAAGCTTGCGCATAGACTCGAGGACATTCT
GATCTCCGCAGGCTTTGATCTTGTGCTCGGACAGTAGCTCCTTCTCAGTGGTTGCGCCAAACTCCAGCACATCTCATCGGTACTGCGGCGACTTTTCGTC
AAGCACGAAGCCTTCAGCGAGGAACAACTTCAAGAACGCAGCGACCAGCTTGGCGTTAGACCTCGTGTGCCTGTTGGCGTCTTCGGTTGAGCTCCAGATT
CGGAACTCTTGGGCGTATCATGAGAACCAGACGTCCTTCagtttgttgctgctgctgcacggcatcTCTTTGCTGGTGGATCATTGCTTGTGTCTCACCT
GTTGCGCATTGTTGTAGATTTTAGCTTCCACCGTAGACAGCCGAACGTCGAGCTTGTCGTTGATCTATCTTAACTGCTCAATTAAGGCGGCTTGGTGAAG
AAACGTTGGGTGCATGGTGATattgctggtgctgtcgtgGGAATTGGTGTTGTCGGCttggaggggggggggctcgTGTAACAGGCCGGGTGCGAAGACC
AAGCTAGAAGCTCATTATTGATGTGGCTTTattttcttcttttttttgGATGGCACGCGCTTTGAGAcgctcgacagcaagtcCACCTGActtgatctgc
ttcagcgattGAtagtggcgcagcaggtaTATCACAAGAGTATCAAGACCCTTCCATTCACGTTGTACGGCGCTGTCTTGAGTCCGTAGGATGCGTTCAA
TAGCGCCGAGGCGACGGTTTGAATCTTCGTATGGGTGTCGGAGTCGAACCATTATAGCGACAAAAGAGGAACAACTTGATCGgaaccccccccccccaca
cacacacacactcaCACGCACACTCACGTCGCGAGCAACCTTGCGACCTTCGGTCGGTGTGTTGAAGACGTACGCGAAGGCCttgctcgtcgctgtcatG
TCCCCCCCCCCGGTCGAAACCAATTGCATATACATGCCGGTTCTAT