Description :
From Genome Similarity Track
Location :
Scaffold_90:85912- 88235
Sequence
2323 bases(100 bases per row)
NNNNNNNNNNNNNNCTTCACTTTTACTTGTTTTGTTAGCGGATCTTGACTTGCGTCAAGATCCGCGGTCTTCCCCGAGGCAACGTGGTGAGGATAGTGAG
GATCTCTTCTAGATCCGGATCCACCTCTCTTCCGTCGACAGAGTTCCTCCCAAAACTCCATCGTCCGCGGATCTTGTTTCATTCAGCAGCGTCTTCGTCG
ATCCGACTTCCGACGACGCCTCTTCCCCTGGCTCAATCTCCACTTGAGCATCTTCTTGGGACTCACGGTGAAATCCCGAGTCACCAAAAGATCCGGGCAC
GCGCACCATTGTGGCGTAGCGGGATCAGCAAAACCTGCGAGATTGCCGATTCCAACTTACCAACTGCACCCAGACACCGACTAACGGAGGGGGTCCCCCG
ATGATCCGTGTTCTGCTGAACTTTCCTCACCTTGTGTACCCGTCGGTAGGGCGGGATCTTGCTCTCTCGGTAACTTCCGAAGAGTTCAAGTGGTGTTTGG
CGAGACGTGGGGATGGGGTGGAGCAGCAGTGGAAAATCTTCACTCTGCGTCCGTGGATTGTTCCGAATCCTAAGCGAATATTCGAGCTTATGGATCCGGG
GCCTAGATCGTAGATCTGGTCGTAGGGTTGCCTTGCGGGTGTGTTCCCTTGCCTTCGTAGTTCCTTTGCGTCGTACTTGCCGCCTCCTGTGACGGAATCT
TGAGAGTTGAGAACCTCTAGGGTGTTCCCGACCAAGTAGTAAATTCGGTTAACCTGTCGGATCTGCACGTGTAAAGGAAATCTCACTAGGTGGTAGGATC
TGGCCAATGTATTATCCAGTTATCGCTACCAACACTAGATTCGCAATTCCCAACCTTCTCCTAGCTCGTACGGCCAATGTAGTTCCGGTTCTTGAGGGCG
GGAAGGCACTTGCGTGATACTGTGCAAATTGAGGACTGTATTGATATTTAAGCCTATACCTGCCTGTATTTCTACCTTCTATGTCTTTCATCTGCTAAAT
CCCTTACCAGGCTCGGGCTGCATGTCCCTTTCTTTCCCTTGACCCATCATCCCAGCTGTATTATCTTCAGATCCACCGGATCCATGGCGTAATCATTACG
GTCACCCTATTATGGGTACACTCATCCGGATCCAGGTCGCTTGGATCCACTTCACTGTAAGTGTACACTCGTCGTGGATCTGAGCTCTCCACTCATCCAA
CCTCATCTCGCCATCGTCTGTGATCCCCATTGTCCCACGAAAGTTCGAGATCCACTGCATCCATCATCCCTATACCCTGGATCCAGGTCCCTCTAGACGG
GATCCTCCCTCCATGGATCCGAACTCGGAAGTATGGGATCTGGGGTACCTCGCGGTGGATCTTGACTCCCCATTAGCCGTGGCTACTAGATCCACCTTCA
GAGGGCACCGACCATCTCTTCTTTCATAGGATCCACACCCGATCCACTCTTGTATAGTATATCCCAAAAGGGTGGATCCGAGGTAAGTCTTGGTGGATCT
TGCCTTCTTCGTACATCGCTTATACCAGATCCATCGTCATTTCCTACGGGGTGCTGCTCATCATGGCTAATCCACCACCGGCAACTTGCATCCGTGCCAC
CAACCCAAATCCTCGCTAATCACTTGAAATTGTCACTGATTCGGGATAGTGACCCCGCGTCAGGCCCATTCTCTTATTTCTGAGAAAGCACTTCACCACA
TACGGAACGCGTAACCGTACTGCAGCTTCCCGCAAACGACGCAGCGCGCCAGGGTATCCGTCGTAGACCGCGTCGGGTAAGCAGAAGAGGGTCAATCTTC
GCCTCGCATTGCTTGCACGTAGGGCCCACCAATTTGTAACCGTGGGAGTGTTAGCTAACAGATTGTATTACGCAAAACGTGCGTCTGAATACCGCCAGAA
TCAATGTTGTGTGAGGCCGAGACGGTTTGATTAGCTGAAGAGGGACACTCTTGCCCAACCATTAGAAGTTTACGCTCACCTTAAAGCAGTAGTTTCAGAT
AGTCGTAGGAGTGAGGAGACACTGGCACGCCATCTATCTTTTTTTAGATGATGTCTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATATTAAAATGTTTCTAAATATAGTATTGCTAGCTTTAATAT
ATTATATCAGATCTCCAAACAAATACATACTTTACATGCAATATAAATCGACTTAAACAATTATCGATCGTGCGCGCATATATTCGTCGGGTACGGTGCA
CGGGAGCAGATACCGCAATGACA