Description :
From Genome Similarity Track
Location :
Scaffold_255:8591- 12493
Sequence
3902 bases(100 bases per row)
TTGAACTCGTACAGCAAAGCTCCACAACTTAGCTGAGACATGGGAAGCCACTCAGTGTCAGGGTACCCCTTCCACTTGACCAAGTACTCCCGGACTCTCC
GTGAAGGCCGGGTCCGCTTAACCCAGCGCACATCCTGGATGGCCTCCACTTCATACACATTCTGAGCTTCATCGGGTTCTTCAGCATCTTCGGGCAACAG
AGCTGCGTCCAGATCATCATCCTCAGCGACTTCAACCTCAACTGTAGGTCGTTCAGGGAACAGGCACGCGGCTTGAGTCGACTTATGTGGACCCAAGGAT
ACAACTTGTACCCAGTCCCTTCGATCTTCAGCTTGCATCGGAAGTCATCTGAGGTCTCCAGAATCCGGAACGGACCGTGCCAGAGGTGAGCGAATTTCTT
CGTGAGCCCAGGTTGCACTCGAGCTAGGTACAGCCACACAGCATCACCAACTTCGAAACCCTTCTTGAGTCTCTCAGACAGCTCAGCCCAGATTTTTGTC
TGAGCAGCCGAGCGTTTGACCTTGGCCTCAGCTTGTAAATCCTTAGCCCAGGCCTGAGCGTACTCGTACTCGCGCTGAGTCTTGCGATGTCACTCATAGG
CAGTCCTCTGATCCAAGCCCGTCGGAGATGGTCCCATCATGGCCGAAACAGTGCTGTGAGGGCCCCAGCCGTGAACCAGGTAGAACGGCGTGTCGGGCCG
GGTGGCGTCGAAGGACGTGTTCAGAGCCCACATCAACTTCTCCACCTGGTCGTCCCAGTCGCTCTAATCTGGCTCAGCGACGTACGCTCGGATGGCTCGA
ACCACTGTTGCACTGAGCGCTCTTGCTTGCCATTTGCCTGAGGTCTGTACGCCAGAGTCACACGCTGCCGACTTCCAGCATCTCGCGGAACCTGGCGAAC
ACTCACTCATGAAGCGTGGATCACGGTCATGGCGGAGCAGAGAGCTCGCACCAAACCTCTGGAACACACACTCCATGTAGGCCTCGGCGACATCTTGAGC
TGTGGTCAGACTCATCGGCTTGCACATGATGAAGCCTGAGAATGCACACTGGAACAGGAGCAGGAACACGTTTCCACGGTCGGACTTGGGTAGATGCGTA
ACGAAATCCATAGAGATCACCTCAAAGGGCTTAGTCGCCAAAATGTTTCCCGGCGACGGCCCAGGGTTGGGCGGAGCTCCCTTGGTAGTGACACAATCCA
CACATTCCTTCACATAGCGTTCCACATCCGCGTACATCCTCGGCCAGTAGTACTCTCTGCGCAGTTGTTCGAAAGTCCTAGTGATCCCTTGATGACCACC
TTCGAACTCCTCATGACTGAGCTGAAGCAAGTCATCCCTCAGCGCCGTTGAAACAACCAATCTCAGATTCCTTGCTGCGTCCCTGGGCCTTCCCGGAGTA
GCTCGACTCAGATAGTACAGGACTCCTCTCGAATCAAGCGTGAACTGGTCCACCACCTTGGCCACATCTTCAGCTTCAGTAGCAGAGAGATTCCCCAAGT
CTCCGTTCAGGTAATCCTTGAGCTTCTTCGTCCAGGGCTCAGCCTCCTGCAGAACTAGGATGCGTCGCCATCGTTCAGCGATAGGAGTTGCTTCTTCAGG
TGAGTACACTAGAGCTTGCTCAGCGGGGGCCTCAGCATTCTGGTCGGGGCTCCGACACCTTGATCGGAGTCTTCCCTGGCTGCTGTGGTTTCAGCGTCCC
TGACCCGAGCTTGGTTCCTAGTCACCACGAAGATCTTAGCGCTGGGCAACAGGGGCTTGGCAGCATACTCCAGCGGAGTTGGCTCAGCCACTACTTCCAC
ATCAGCTTGAGTGTCAGGCTGCTCTGTCTCAGGTTCAGCAGGCTCAGGTTCATTCACCTTGATCAGCTTCTCCGGGATCCGATTCAGTTGTTTGAGCTGA
ACCAGCTCAACCGGATCCTCAATGGCGACAGGACCTTGAATCACCAGAGTCTTCGACGTGAGGTAGTCCGCAGCTGCGTTATATTCTCGCTTCACATGTA
CCAAGCGCAATCGTTGGAACTCTGGTCGAAGCGTCTCAAACTCAGCTAGCAGCACTTGCAGCCCTGGGCTCAGACACTGGATCAAGCCCTGAGCTTGCTG
AATGACAATCCGAGAGTCACCGACCACCACAAGGTCTGACATGCCACGAGCCTTCGCCATGCGAACTCCCTCGAGCAGTCCATGGTACTCGGCTTCGTTC
ACCGTAATGCCTTCAAAGTGGAATCCTCGAGCTTCGACCGGGAGCTTCCACAGAATGCAGCCAGAAGCACCAGAGCGATCCGAAAGTTTGGCAGCTCCAT
CAAAGCTGAGCAGCCATCCCTCGTAGTCCGCTTCCAGCACCTCCAAGCTGATCGGTGGGGCTCGGACAACTCGTCCCTTGTCCGGGATGAGGTTCTCTGC
GATCTTGTCCAACTGGTCACGGGGGTGATCCCAGCTCCCATGATCGCGGCCAAACCATCTTCATCGCGCTCGACCCTATGAACCTCCAAGGGCCAGAGCG
ACAGACGTGCAGCCCACTGCTCACAGCGTCCCTCTAGCGATCGAGACCTGAACAACCACTTCAGAACAGAATACCGGGTGTAGACCTTCAGCAGCTTGCA
ACCGCTCAGCATCGAGTAGAAAACTCTCAGAACCCGGAGCAACGCAACGACCTCCTTCTCAGCCGGGTGGTATCTGAGCTCCTGATCATGCTGTGACCTC
CCAGTGTATCGCACCGGGAAAATGACTCCATCATACTCTTGGCCCAGCACTGCACAGACCGCCCAGGGGTTAGCGTGTAGAATAATCACGAACGGCTTCT
CCCTGTCCGGGTGTCTGAGCAGTGGGGTAGAGACAATCTTTTGCTTCAGGATTTCAAACGCCTCCTTAGCTCGGCCGAGATCACGTCCAGCTTGGATCTG
CTCATCCGCCAACTCGTAGAGCACAGACGCTACAACCGGGAGGTCTTCAATAAACTTGTAGTAGTAGTTGAGACTTCCCAGGAATTTTCAGCGTCGTCGG
GAATGGCAGGTCCTTGACTCCCTTGGCGATCTTCGGCTTAGCTCGGATTCCCTCAGCTCCAATCTCATGCGAGAGGTAGGAGATAGACTTCTTGCCAAAC
TCACTCTTGGGCAAGCTTACTGAAATTCCCCAGTACCTCAGTCGATAAAGCAACCGATCCAAGACTTCGCACATCTGGTCCCAGGTCTCGGCTCCATACG
CGATGTCGTCGATGTAAGAGCTTCGTCCCAGAACAGGACTCAGCTGAGGCGGGGCCGGAATGTTTCGCCGGAACACGGTAGTCTCCTCAGACAGAGGCGG
GATTTCTTCCTCCTTAGCGGAGTCGTCCACCTCGATTCCTAGGAACTCCAGCACATCCGGATCAACTCGGGCCTCCTCGCAGGGCGGAAGTCGCACGAAA
CCCCACAGACAATTATCGAGCATCTGCTGGTAGATCAGCGGGGCGTTCTTGAGACCAAACGGCATGCGCTTCCACTGGAAGTGTCCCAGCGGACAGATGA
AGGCTGAGATCAGCTTGGCCCGGAGTGTCATCGGCACTGCCCAGAATCCGCTGGCCATGTCCAAGCTCAGGGACCACATCGCTTCCTCAAACCCGATCAA
CAGATCGTCAATCAAGGGCATAGGGTAGTGTGAGAGCTTGATCAGTTGGTTGACCAGTCGATAGTCGATGCACAGCCTGATATCCACACCGTTCTTCTTC
ATCACAATCACAATTGGCGAAGCCCAGTCTGAGTGCGAATACTCGATGAGCCCAGTCTCCAGCGACTTCTTGATCAGAGCAAACACCTTGTCGAGCAAGT
GCGTCGGAACCTGCTGAGACCTCTGAGCGATGGGCTTCGCATCCCCTGCATCCAGATCACAGACAACTCCATGGGCGGGGGCCGGTACCGCATTCCCGTC
CC