Description :
From Genome Similarity Track
Location :
Scaffold_103:859- 2224
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_103-fgenesh-gene-0.0Mitochondrial-processing peptidase subunit alpha

Sequence
1365 bases(100 bases per row)
CCAAGATGCTCGCGGGGCTGCCGAAGGTCGCGGCGCGCCAGGCGCCTGGCGCTCGCTCGCTGTTCGCCAAGGCCAGCGCGATGCCGGCCGTGCCGCTGAC
GCAGCCGTTCCCGTCGGCGCCGGCATCGAGCCCGACGCCCGCGGCCGCTCCCAAGATCTCGTCGTCCGTGGCCAACTCGGGGCTTGTCATCGCGTCGGAC
GGCGCCGCCGCGCCGATCGCCACGCTCGGCGTGCAGCTCAAGGCCGGCTCTCGCTACGAGTCGGACGAGACTGCGGGCGTCGCGGCGCTGTACTCCAAGC
TAGCGTTCCGCGCGACCGACTTCCGCTCGGACCTGCGTTTGTTCCGCGACATTGAAGCCATCGGCGGACGCGTCAGCGCCTACGCGGGCAAGGAGTACGT
GCGCTTCAGCATCAGCGTGCTGCAGGACCAGGTGGAGGAGGCGGCGGAGATCCTGGCCGAGACGACGCTCGAGCCCAAGTTCGCGCACTGGGACATTGAC
CAGCAGAAGTCGCTGGTCCGCGCCGAGCATGAGTCCGTTCTTGCCAACCCGTCGGCTCTGCTGCTTGAGAACCTTCATGCTGCTGCCTTCTACGATGATG
CCACGCTCGGACGCGCCACGTTCGCTGTGGACAACCTGGGCAACTTGGACACGGAGGAACTGTTCGCGTATCATCAGCAGTTCGTCAACACTGGCAACGC
GGCGCTCGTGGCGACCGGCGTGACCCACAGCACGCTGACCGACATCGCGAACAAGTTCTTCGCCTCCATCCCGTCGGGAACCGCGGTCAAGCCGGCGGCG
GCTCGCTACGTTGGCGGTGAGAAGCGCGTCAAGGTGCCGAGCTCCAAGTTCACGAACGTGGCGCTGGCGTTCCCGACCAGCGGCCGCGACAAGGCCGAGT
ACGGCGCGACCCACGTGCTGCGTGCGCTGCTGGGGCTGCGACTCAACCGCAAGACGTCCTCGACGTTCCTCTCGAGCTACGAGGACGCTGGTCTCGTGGG
CTTCTCGGGCTTTGCGCGGCCGCAGGACGCCGGCACGCTCGTGGACTCGTTCATCGCCGAGATCAAGCGCGTGGCGACCACGGTGCCGACCAAGGAGGAG
CTCGAGGCCGCCAAGAACATCGCCGCACTTGGCGCGCTGAACGTGTACGGCACGCGGGCGGGAGCGCTCAGCCGCGTGGGCATCGTGACGCTCACGCCGG
ACTTTCACTCGCGCTCGCCGACCGAGCATGTCGTGCCGGTGACGGGCGAGACCGTGCAGGAGCTGGCCAAGGCCGCCGTGGCGTCCGTGCCGTCCATTGC
GGCCGTCGGCAAGCTCACGGCCGTGCCGCACCTCCACGCCGTGTGCAGCAAGCTGCAGTAGGCAA