Description :
From Genome Similarity Track
Location :
Scaffold_608:859- 1881
Sequence
1022 bases(100 bases per row)
TCCCTAAACTCCGCTCGAGGCGGCTCAAATGTTTGCCTAAGCAGGGAATTGAAGACTTCATACGACCCAAAGACATATGGGTCGTGTAACTTCAGGCCCA
AGGCCCACGTCTTTGCACGCCCTGCAAAGTTCGATTGAGCAAATGCGATCTGCATTTGCTCATCGTCGATGTGGCGAGTCTTTATGGCATCGTCTAGTTT
CACGAACCATCTCAACAGAGAGTCTTCGTCGGCTCCCTTGTACTTTGAGATGTCAATCTTTAGAGTCTCGGGACGATGTGTATACGTCGACCCGGTAGCA
GTGGCCTGCTGCTGTCTCAACAGTTTCAAACTGTTGAGCACTATGTTCTCTTAACAGCTCTGTCTGTTGAGAACCTTGTTGGTGAAGCAAGGTTACCTTT
TCCCGCTCGACGTCAAGTTCATTCTGAATGAACTTGGCGATGGTGGCGAGCTGGCCATCCGGCCCCAGGGCGAACAGCAGTGCGCCAACGGCTTCTTACC
CTATCGTCGAACTCAAGCGTTCGATGGCATCCCATTCGATTTGACTCAAATGGGAGTAGCTTTCATGCGTGGGATGAAAATCATCCCCCTCAATCGTCCA
ACATGTTCATGGTCGTTGAACGGACTACGAAGTGATACCAGGTGTAACGGGGCACACCTTATTCAACTAACTGAATAAACCTTGCACTGCTGACAGTGCA
AGGGTGTGTGCGTCCGACTACCTCACGTACACGTACGTGCAGAGGAAGATTGCTATACGGAGTAAGATCACTCAGTAAAGGTAAAAAGTAGAACTGTACT
TAGTATAGTTAACCATTTTAATAAATCCCTATTTGACTTCATTTAACTATGTCTAAATACAAACATGTATTGTAACTATCTGCGCACCACTCATTGCGTG
CTTCTGTCGTGGCTAGACTTTATTGGTTGATATCTCGATCCTTTAATACAATATAACATTAATATATGGTAAAAAAATTAATAATTAAAATAAAATTTAA
AAACTATTTGAATTTTTTTTTA