Description :
From Genome Similarity Track
Location :
Scaffold_130:85897- 87008
Sequence
1111 bases(100 bases per row)
ATCAAGCGCATAGTGAATCTCGTGGGCTTTGTCAATTCATCGATGGTTTGTCTCAACAGCCAGCGATCATCAATGGTGGGGCGTCCGACAATATTGGCAA
AGTGTTTAGCGACAAGGGCATTCACACCCACTCGGCTGTGGGCACGAACGCCCTTCCGCTAGATGTGGTTGTGGAAATCGAGGCCGTTGTTGAAGTCGAG
GATTATAGTACTTATATAAAAGTGTAGGCGTCTAGTAGCGATTCGATGGTTAAAATCATGGCCTATATCAACCAATGATCAGACCTTAAAGTCACTGCAA
CAATAAGACTGCAACCAGTAATATTGTCAGTACGATCATCAATGGTAGTATCATGTAACAGGATCACCCTGATACACCACTACCCCTAACCAAGAGTCAC
GCTGGTGACTATTTGATTAAGTGACCGGCCGCTCGGTCAAACGCTATGACAGGGAGCATTTGTTCGATCAGATCCACTCATTTCTGACACCGTTTCACAT
GGTTAACAAGCCTATGAGAAGCGCGTCAAAGCTGCACGGAAGGTAGCTGCACGTTTGAATGCTACTGCAAGCGACAATACACTTTGGCTCAAGCGGAAGA
CATGCAATTGATGACCCACAGGAGGATCTATCTACCCTGGTGAGTCGAACGGTGTGTCCGACTAAAAGACTACTAGATTGCCTGAATCATCCTGGGCGGC
CGAAATATAGCCTTCGAAAAAGACGACTCGGCCAAACTACAAGACCAATACGTTGTATCATAGTCAGTTTGGGTCAACACTTTTTCATTTTGATATAGGG
TAGTCTTAAGTACTGGAGTAAAAGGGATCTTTCATTTATCTTTAGTTATGTCTTAACCTACTTTTCACCCACTATTCTTCTTGTCCACTCAATTACAAAA
GCCGCATATCGTTTCACACAATGTATTCACAATACGAACACCAAGTCAGCGGCCGCCCTTCCAACGTAGTCCGGCGCTCCTCACGCGCAATAGTACTTAC
GACGACACTCTTTTCCAAGAAACAGATGATCATGATGGCTCATCATCAACGCTGTCTCATGCGTACTCACAAGATCGCGATAAGTTGGTGAGACCATCGT
AAACTTCTGGC