Description :
From Genome Similarity Track
Location :
Scaffold_1:858849- 860290
Transcript NameFunction/comments
Aphas_H257_00301succinate semialdehyde dehydrogenase putative

Sequence
1441 bases(100 bases per row)
CCAGCCCCACAATTGACCCTTCGCGGCCTTGTCCAGACTGCTTGATGCCGCCAAACGGCGCCTGCACCGCCGAAATCACTCCGGCATTGATGCCCACCAT
GCCGGCTTCCAGCGCTTCCGACATGCGCCACGCGCGTCCCAGGTCCGACGTGAAGCAATACGCCGCGAGCCCCATGTCCGTGGCGTTGGCCATATCAATC
ACGTCGGATTCTGTTTCAAACGCCAGGAGCGGCACCACCGGGCCAAATACTTCTTCGTTGGCGATGTGCATGTCTATCGTCACCTTGGCAAGGACCGTGG
CCTGCATGTAGTTGGGCCCGAGGGCTAGATGCGGACGACCCCCCACCAGCACCTGCGCCCCCGCTCGCACCGCTTGCCCCACCAACCCCATCACCTAGTC
AAACCCAATCATGGTATATCAAATCCTTGTTTCACACGGCAGTACCTTGTCCACCGCCGCCGACGTGATCAACGGCCCCAAGTGACAACCCGACGACACC
GCATCTCCGAGCGTGAGATCCAGCACGCGGTCGACCAGTCGGCCAGTGAACTTCTGCAGGATGGTGGCTTGGACAAACACGCGATTGGGGCACACGCACG
TCTGCCCCGTGTTGCGAAACTTGGCCTGGATCAACCCGTCAATGGCTTCGTCCATGTTGGCGTCGTCAAAGACAATGAACGGCGCGTTGCCCCCCAACTC
CATCGACACGCGCTTCATGGTGGTGGCGCATTGCGCTGCCAGCAACTTGCCCACTGACGTCGAGCCCGTGAACGATAACTTGCGTACCTACCACACATCG
TGATCATGGCAGCTGCATCAGACACAAATAGAGAGAGGACGATGGCTACCGTGGGATGGGTGGCCAGGGCGCGTCCGATGCGTGGCGCCGCTTCGTGAGC
TGCTGGCACGATGTTGAGCACTCCGTCCGGCACCCCGGCATCGTGGCCAAGTTTGGCGAAGGCCAGGGCCGACAGTGGCGTCGTGCCTGCCGGTTTCACC
ACCGCCGTGCACCCCGCGGCCAGCGCGGGTGCCACCTTCCGGGCCAGCATCCCAATGGGGAAGTTCCACGGAGTAATCATTGCACACACACCAACGGGTT
GCCGCATCGCCATCAACCGACGGCCGGGAAGATGGCTGGGGACGAGAAACCCTTCGTGCCGAAGACATTCGTGGGCGAAGAAGCGCAAGTAGTCGGCGGC
GTACGCGACTTCCCCCGCGGCTTCGGCCAGCGGCTTGCCGCTTTCGGTGGCCATGATGAACGCCAAGTCATTCGTGTTGTCGCGCAACAACCGGTCCCAT
TTCTGCAACACACCGGAGCGTTCAAACGGCGTGCGAGACTTCCATGACGCCAACGCGTCACCCGCGGCCGCGACCGCAGCTTCCGTGTCGACCACGTCCA
TGGCAGCAATGCTGCCCACGTTGGCACCAGTCGATGGGTTC