Description :
From Genome Similarity Track
Location :
Scaffold_5:85880- 87494
Sequence
1614 bases(100 bases per row)
GCGCGTGACGCCTAAAGTTTTCGACGTCCAGTAAATCCATGGCTCATGGCGCTCAAGCCAAGCCATACCAAGAATGAGATCATATATCGAGTCCAAATCA
AGGACTAAACAGCGTTCGATACTATCAAAATCAAGTAACTTCACACCCAAGTTCACAGAAACTGTGGTGACGAGAGTCCCTGGAGCTAAGCGAACAGTGA
TCGTATCACCCTTATGCGCTTGTAGCGCCTCAACATAACGTGGATTCCCTTCAAGAGAACAGCGTCTGACATAAATGCCGGATGATCCGGAGTCGATCAA
AATCAATCAGGGTTTGTCAAAGCCCTTAACAGTCGCCTTTGTGACCAACAAGCCTGTCTTGTATTCACGCCCCGTGTTAGAGTACACGGGAATCCTTGGT
GCTAATTTCTGCTCGCCAATACCTTCTAGAGGCTGAACAGAACCTATTTCTTCCCCAGCAGGGCTCCCCGCGCCTACTGGGAGTCTACGTTTTCCCGCAC
CGTACCAGAGTTCTGGTTAGCGGCGGGGGTTCGGCCTGAAGTAGCCTGGCGTGCCCTGCGTGAAGGGGAATTAGGTCGTAGATGCTTTGTGCTTCCGCAC
GTGAAACATCGTCGAATGTTTCGATGCTGTTCTACAGCTCGAAGCTCTGCTTCTTCGTCCGTCTTGGCGAGACTGAGGTCCATAGGCTACGGTCTATTGA
ATGAACTACAGGAGTTCGCCGAGTTTGGGTTGTACCCATGGGCGCCAAAACGGACTGCCTTAAAGTTGAACTCAGCGTTCAACGCGATATCCACAGCCGC
CTCAAAGAAGGTGGGGTGTACCCGGAATACTTCCGTTCGAGCCACGCTCGTGCGAAGGCCCTCCATGAAGATGGTAACCAAAGCCATTTCTGGTAAGGGA
TCAAGCTGCGTGGAAGCGATTAGAGTTCTCAGTTCCTGGACATAGTTCGATAGTTCTTTCTTGCCCTGACGAGTAGATAAGAAACGAGAACGCACCCGGT
ATGCCTGATTAGGCGGAGCAAACACCCGGGATATTTGCTGTTTTGGCAAACCCCATGTGGGAAAAGCTTCGTCTACCGACGTGTTACACGTGAGAGCCCA
TTCTCTGACTCTACCACCCATTTTTGAGATAGCCATCCCAACTCGCTGTTGCTACAACTGGAGCATAGCAGAGTTCATAGCCATTTCCACCTCTCTGATC
CACAGGAGGAGATTCTCCCCTTCTTTTCCCTCAAACGTCTATACAGTCAAGACAAGGGGTCGAGCCCTTGGCTCTTTATTAGGTACGGGAACATATCGAG
TAGGCATAACCGATGCCAAATGGTCGTGTACTTGTCCATTCAAAGTGGACTCAAACTGCATTAAAGCGTCAAGACGTGCACGAATCACGTCAGGACCTTG
TGCTAGGATTAAATCCACTCGTTCGTTCCCGACTAGCACTCTGAGTTTCTCCAGCGCTAATCCTTGGGCCTCAGAGAGGTTTATCTTTGTTTCCATCCTT
ATAGAAAACAGTCTTTAACAGAATCAGATGTAGATTGACTACAAGTGCTACCAAGTGTAGCGGAGGTACCCTTACTCCTTTGTCAGAGAAAGACTTCAAG
ACTCGTAGAGTCTC