Description :
From Genome Similarity Track
Location :
Scaffold_153:8588- 10196
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_153-snap-gene-0.19Protein OS-9

Sequence
1608 bases(100 bases per row)
GTGCGCGCTCTGCTGCTGCTGTTGCGCGAGCGCAGCTTGCTTCTTCTCGGGCGTCAGCGGCACGAAGCACTCGAACTGCTGGCCGGACTCGATGGTCATC
ACCTNNNNNNNNNNNNNNNNNNNNNNNGCCGTCGCGACTCGCATGGATCTGCACCACGTAGGACGCGTCGCTGCTCGGGAGCTGCAGCGCGTGCGCATTC
TGCACCGTCGAGACGGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCTGCCACCACGAGCCTCATCTTCAGCCTGAGCTCTTCGTTGTATTT
ATATGTGATCTTCTCACACGNNNNNNNNNNCGCCACGTGATACTGTAGCAGACGCGAACTTAACGATGCGTTGAGCGACTCGGGAGCGTACTTAGCTGAC
ATCGTGGCACCCAAGCACGTAGTGACTCATGCGCGCGAACTTAAGGNNNNNNNNNNAGCGTTACCTCAACGTTTACGGTTACAGACAGGTCTGTTTGACA
CAGATCAGAAAAGAGAACCAAAAGCACGAAGAGCTTCATGGTGTCGACCGCGGCGCTCGTAGCGGGCGTCCTGGGTGGCGCATGCGCGCTCGCCACTGCC
GCGTACGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCACCGCAGCCACCGCGGCGTGTCCAGCATCCCGCTGTCCGAGTACCTCTCCTTTGAGGCG
CGCGTGCGGTGGCAGTCGCTGCTGCTCTGGCTGTCGGGCGTCTCCAAGGAGCTCGAGGTCCTCCCAGACGCCGACACGCTCACGCCGAATGTGATCCGCG
TCCTGGGCCAGAACCCGAGTCGGATGACGTTGCGTGGCACCAACACGTACCTTGTCGNNNNNNNNNNGCGCCAAGCGGATCCTGATCGACGCCAGCGACG
GCAATGCGGCGTACATGAAGCATCTAATGCAAGTGTGCGAGCTGGCGCGCGTGCAGGAGATTNNNNNNNNNNNNNCTGCTCACGCATGGCCATTACGACC
ACATGGGCGGCATTTTGCGCGTGAAGGAAAAGTTCCCGAACGTGCGCGTATGGAAATACCTGCCACCGAATGGCGNNNNNNNNNNGCGTCTCGAACGCCG
AGTGTGAACTCTTGGGGATCAAGCATCTGGAGGACGGTGCCGAGTTTCCAGTGTCCACTAGTGCGAACGATAGCGACACACCAACGATGAGTACGTCGCC
CTTCGTACTGCGCGCAGTGTACACGCCCGGCCACTACAACNNNNNNNNNNNNNNNNNNNNNNACCACATGTGCTTCTTTCTCGACGACACAGCCACCAAG
AGCGAGCGCGCGCTGTTCTCCGGAGACTGCATCCTGGGTGCTGGTAGCTGCGTGTTTGACTCACTCAAGGAACTCATGACGTCGCTGAAGCTCTTGCAGA
AGCACGATCCGCGCGTGATCTACCCCGGCCACGGTCCCGTCGTCACAGACGCGCAGGCCAAGATCCACGAGTACATTTCGCACCGCGAGCAGCGCGAGAA
CCAAGTGCTTGAGGTGCTGCGCAAGGCCAGCGACGCGCTCTCGACGGGGGAGATCGTCAACCGCATCTACGAGAAGCTCCCGTTCGCGCTGCAGCTCGCG
GCGCGCAA