Description :
From Genome Similarity Track
Location :
Scaffold_181:8588- 9591
Transcript NameFunction/comments
g4850.t1hypothetical protein

Sequence
1003 bases(100 bases per row)
TAGTCCACCATATTCCCCGGTCGAATGGATCCGTCCGCCCCGGTGAAGAACTCCGGGTACTTGGAAATACTCTTCCCCAGCCGCTGCCAACCACAAAATC
ATCAGTTCCATCTCATAATGACATTAAACAATAAAACAAGTCACCTTGAGCAGATCCGTCCGTCCAGCGCAACCCACCAACGGGTTCGCATCACTCTACA
AACCCCAAAAAATGAAAAACCCAAAAATTGGAACCAAGCTCCCAAAACTTCAAACTTCAACTTCGCCCCCTTACCACTTGAAAAGCGTTGGCAATTGCAT
CGTCAGGTAAATCGGCCAGCGCCTGAGCGTCCACTCGATGCGGGTCCTCATCGGCCGAGAAGTTTCCTTGTAGAAACATGTGGAAGCTGGCGATGCCCAG
GCCTTCACTGCGGCTGTAGACGTCTTCCGTTCCCGGCTCTTTGTAGGTCCACGTGGGTCCAGCACCGGCGTCCAAGAGGACGCTCACGAGAGCCAAGTCC
AGCAGCCGCCGAGCCTTCTCCAGCTTCTCGCAGCGCCAGGTTGACGTCATCGTGTCCACGCGATGCGGGTTACCCGTCTCGAAGTGGCGCCAGCGCGAGT
GGAAAGGGACGTTGGCCTCGTTGGGTGGCGGATACGACTGACGAATGACGGTGATAACGTAGTCCGCCAGCGCCGGGATCTTATCCTCGACCACCGAGAA
GTGCGGTAGCTTGTCCTGCTTAGCGAGCGCCAGCACGCGGTGGCAGCCGTCACGCACGGACGGCAGTGAGCGCAGATACGCCACTTGCTCTTCGGGGGTC
GATGTCATGGGGAGGGACGAGAAGTGCTTAGAATGGATTGCGTAGCCGTCCAGAGGAGCCGGTCTAGAAGTGAAGTGCTGCAACGCACCCGTTCAACATC
GATCTTCTCGGCTAAGTACGATATAGTTCGCATATCGTATTACAGTAAGATGGGAAGGTGAACGTGATAAGTCGGAGGCGCTTCAAACCTGTTATATGGC
ATG