Description :
From Genome Similarity Track
Location :
Scaffold_26:85879- 128913
Transcript NameFunction/comments
Phymu_g1644hypothetical protein
Phymu_g1645hypothetical protein PHYSODRAFT_491946
Phymu_g1646hypothetical protein PHYSODRAFT_497615
Phymu_g1647hypothetical protein PHYSODRAFT_354318
Phymu_g1648hypothetical protein PHYSODRAFT_313196
Phymu_g1649hypothetical protein PHYSODRAFT_465114
Phymu_g1650hypothetical protein PHYSODRAFT_313194
Phymu_g1651hypothetical protein
Phymu_g1652hypothetical protein PHYSODRAFT_493289
Phymu_g1653hypothetical protein PHYSODRAFT_369743
Phymu_g1654hypothetical protein PHYSODRAFT_388544
Phymu_g1655ABC transporter ABCF family
Phymu_g1656hypothetical protein PHYSODRAFT_488619
Phymu_g1657hypothetical protein PHYSODRAFT_313188
Phymu_g1658hypothetical protein PHYSODRAFT_488938
Phymu_g1659hypothetical protein PHYSODRAFT_313186
Phymu_g1660hypothetical protein PHYSODRAFT_492063
Phymu_g1661hypothetical protein PHYSODRAFT_492857
Phymu_g1662eukaryotic translation initiation factor 3 subunit, putative

Sequence
43034 bases(100 bases per row)
CTCTTGTCAATTAGTTAGTGCATGCAAAATACAGGACACCACACCAACCTCATCCCGCAAGAGCGACATCCCGCCGTCTGATACAAGTTTGACCAACCGC
TGCAGGGTTCGCGAATCCACATACTTTTTAACCTCAACAGTAGATAGCATGCGCATAGACTGATTGGATCCTTTTGCAGGAGGCGGGCACACGATACTTT
GGAGTTTGCGAATAAAACTTTCAGCTGTAGGAGCGGAGGGGGCCATTAATATTCGCTGCCCTTTACTTGATCCGCTGGTAGGAGCAACTGCAGGTGCTGT
TTTCCCTTTGTCTTCTGGTATAAACAAAATAGATAAATAAATTCATGGTTTGCAAAACGGAATAACGATAGATCCAAAACCAACAATGCTAAACACACCG
GATACTGTCACCCTAAGAGCCTGGTAATCGAGGTATGCTATGTGGCGCATGATTTTTCCCTGCTGTATCAGAAGATCATCAGACGACGTTGCTATGCCCT
GCAAACACATAATAGCAACATCATAAAGTAAAGCCTGCACATTTGGCCACACCCATAACTGTTTATCACGCACCGCCTCTAGGTCGCTCATGAAAAATAG
AATCTCTGGGTCCGCAAGCGCCTTATGGACAATTGTTTGCCGCAAAACCTCGTCATTGTCTCCAAACAGACCTGAACGACAACGAACAATATGCGTAATC
CGACGTTGACAAATAAATACCATACCAGGAATCAGCAGGGACGTACGCCGAATTAGCGGTCTCATCGTGgactcctgcagcacgtctGCTCCAGGCGCGA
ACATCTTCAAGCCCCTGGCTGCGGCTGAGACCACCATTTCCAACTCGCACTTGTTAAGCGTCTTCAACCCTCCATTGTCTAGAAGAGTCAATACAACTGT
AGCCGCAGGCGTTAGTTCGTGCGAGACGATTGTTTAACACGCCGAATGCCCTCACACTCAAACTTCTGGGGCTTTTTCGCATCCACAAGTAGGGCCAGTC
CGCTAAAGAAGTCCATGACGCCGATCTTCCTAGCCTGCTTAACGTCCAGTGCCTCAAACATGGCTAACATTTGCGCCTTGTCGTTATGGAGACAAAGCGG
CGCCACGATGACTTGAAACACTGAAAACGGCATGAAATACTGGAATGCGGGGTCCGTTCGTCGGCGATGCGCCTCCTGCTggaagcggagaagaagctgc
tccagctccacccACGAATGGGGCACTAGTGGCCGCAGTTTCCAGCGCACACCGCCGCCATCGCCCCCCTTCGAATGGCTCACGCCCATAATGAATGCGG
AATGCTTGTAtcgacttcaacatcgaTCTGATTGGTCGTAAACATGTTTGCTCTGGCCAATGACATGATCGCTACATGCATGGATTTTTTTACACAGTCA
CACTGGAGTCATTGAGGAAGGAAGCTAAGCCAtggagaacaagttcatCCCGCAGGCGATCGAGATCGTGACCGACGCCATAAATGCcgacaacgccaag
aactACCAGGATGCTTTCCGCctgtacaagaaggcgctcgagCACTTCATGGTCGGCGTTAAATGTGCGTCTGAAGTTGTGCTGAGGGGATCAGGTCTTC
AAGTTTactgagctgctggctgttgTTGTGCCATACAGACGAAAAGAACCCGACGTCCAGAGAGATTATCATGAAGCGCGTAGAGGGCTACATGACGCGC
GCAGAACAGCTGCGGgggatgctggagaaggagaacgcaCCGAAAGCCGTAGCAGCGGCGGTGGACATGGACAAGTGAGTGTTGCAGGGGTTTTTGTGCA
TTTCTGGTACTGATACTGCTGTATACAGAGGCGAAaaagatgacgaggatgaaaCAGACGCAGAGACAGCCAAATTGCGCGGTGCATTGTCTTGTAAGGT
TTTGCATAGTAGGAACTGGTCAAGTTGTTTTTTTGACAGGGCTTTGGACATGGTGCTACAGCGGCGGTCGTGTCCGAGAAGCCTAATGTCAAATGGGACG
ACGTGGCTGGACTCGATGCGGCAAAGGAGGCGTTGAAGGAGGCAGTTATTTTGCCTGCACGGTTCCCGCAGCTTTTCACAGGGAAGCGGCGTCCTTGGAA
GGGTATTCTGCTTTATGGGGTAAGATATTGAGGGTTATTTGTAGGCGTCGCTGAAGTTGATTGCGCTGAACTGGTTTTCTGTGTGTAGCCCCCAGGTACC
GGTAAATCCTACTTGGCTCAGGCCGTCGCAACGGAGGCGGACGCCACGTTCTTTGCTGTAtcatcctccagcttggTCTCCAAGTGGCAAGGCGAGAGTG
AAAAGTGCGGAATCTATATTGCGATACTGTGAAGATTAAAGTTTATCATTGCTAACTCATTTGTGGCTTGCGCTGTAGGTTGGTCAAGAACCTCTTCGAG
ATGGCGCGTGAGAAAAAACCTGCTATCATTTTCATAGATGAAATCGACTCGCTTTGTTCGAGTAGATCTGAAGGTGAAAGTGACTCAACACGCCGCATCA
AGAACGAATTTCTTGTTCAGATGCAGGGGATGGGCAACAACCATGACGGCGTTCTGGTGCTCGGAGCTACGAACGTACCGTGGGAACTAGACCCGGCAAT
GCGACGACGGTAAATATTTGTTTGTTGAAaggaggggggggggattTTGCAGATAGCTGATGCTGTATTACAAACCTGCAGATTCGAAAAACGCATTTAC
ATTCCTCTCCCTGAAGTTGATGCACGGAAGGTAATGCTGGGCATCCACTTAGGTGATACGCCAAATGAGCTGAGCGACGCAAACTTCACAGCTATTGCGG
AGAAGACGGAAGGGTACGATATTCTAGATCTCGACAACAGGATGCTGGTACTCATTTTTGCCGTTTCACTAGCTGCTCTGGTTCGGACATCTCGGTGCTT
GTTCGAGACGCGCTCATGGAACCGCTTCGAAAGTGCCAACAAGCGCCATTTTTTACTCCGGTAAGGCTGCTGATAGACTCCCGCCTGGTTGTGCGGGTGT
TTGACAACGTTTCTTGATTTTGTTTCTACGTGCAGTGTGATGATAAGGCACACCCTGTTCGGAATGGCCCATTCTTGACACCTTGTGAAGATGACCCACC
GTGCGCGTACTGCCACATGAAGCTTTCAACATGTCGCCCAAAATGCCCAGACTGCAAGGCCCCGTGCCGACGTTGCGGAGCGCTACGCATGCGGCTCTAC
GATCTACCAGATCGTGGCTATTCTGATGAGAAGCTGCGGCCCCCAATGATCTCAATGGTAATAATGCTTCGCTTTCATTTCCTTAACTTGTGTACTGGCT
AACTGGGTTTCTACTACAGAGCGACTTCACTCGTGTCTTGGAGCATTCGACAGCAACGGTAGCTCCTGACGAGCTCAACCGCTTTGTCAAGTGGACGCAG
GAGTTCGGGCAAGAAGGCTAGAGTATCATAGACAGATGGTTCCGTCATATCCATCTTCTATAACCGTGTCGATAAATGGCTACTTCATTGCTTAGTTTGT
CCCAGCGACTCGATTATACCTTCTAGTTCAACAGCGGAAAAGTGGTGTGCGTCATTGCAGAAATGACAGGTGAGATCCACACCAGCGTTACCTACATCAG
TTGCAATTTGCTTCAGGTCCGTTGCCCCCATGCCCTTGAGACGTTCTGCGTAGGAGTCCTTGGAACAGCGGCAGTAGTAATCCAGTGGCACCCGCTTACA
ATTTTTATCGGTGACATCCGCGCCTGGGATCAGTTCGTTCAGATACTCCAACAGGTCCGAGTTCTTTTTAAGTTCAGCGGCAAGGAACGGAAGCTTGTCG
AACGCCAACTCTTCAATCTCATAACGCCGCTCATGCGCTTCTGTTGGCGGCATTTTCTGGACGATGAGACCACAGCTGCGCGTGTGATCTTCGGTTGCTT
CGCTATCAATGCGCACAATGGTTGGGACCTGCTCCGACACGTCAAAAAATCGCTGCCAGTCAAGCTCGGGCACCCCAGATGCCTCGATGGATGTGTTGTA
TGGTTTCGCTGCGCCGTACAGAATCTTGGAAACGTGCATGTGTCCTCCACGTTCCGGTGCTCCAGCAAGCGACTGGTCCACGTAGACGGCTTTGCCACGG
ACCTGCACAGCAAAATAACATCAATAATCTTGTTTTGTCCCACAAACACCAATGCAACAACACATGCACACCTCTCCGACTGCCATCGCCTCGACGTAAA
GTTCTTGAATATTGGGCGTCTTGACCATCACCTTAACGCGCTCCTCGCCCTTGAAAAAGGAGCTGAGCATGGCGGTGCCGGCCATGTACTCGCCCCACAG
CTTCGTGCCTTCCGAGGTCGTCGGTAGCTGCCAGCgctgcgccacctcctccacggCATTGCGCGCCATCACTCCGGAAACGCGTAAGTTGCCCACCTGA
CAACGCACCACCACATCACGCAACGGCCGCTTCCACatcatcaagctgctgccaacCGCTACCGTGAATTTGACTGatggtacagtgtaccaaATGCGTC
ACCAAGTTGCCTTTTTCCGTTGGAGTACAAGCTGCCTCGAGATGTCCTGGCAGCGCACTCGatccttctcctgcagctgcaacaccttGCACTGCTTTCT
ATAACCTGATGAGTTGCCCTCTCCGCCCGTGTTCAGTCTCCGAGATGATGGTTCGCGCTCGGGGTTAACAGCTTTGTTCGATTGATGAGAAGGAAACAAT
GAAGCCACATCGACACTCCCACCGCCGCCAGAATTCACATTTGATGAATGGCATTGTGTTCTCGCCACCTTTTCACACGCACAGATTTGCTTCCACATAT
TCGGCAGGGCTACaatgttgttgaagctgttcatcTCGGTGTGGATAGGGACGTGAGCCGTGGTCTTGCATCCGCGGATTGAACTTTGGTCGGCACTGAA
TAtgcgagagctgcagcaggaataCTTTGCAGCTGGGCCAGCATCAACGATGGAGCCGGGGTGATAAGCGCAGTTTTGTAGTTCCATCATGCTGCATATC
TGTTTGCAAACACTGCAATGGAAATATTGGGTGGAGCCCCAAATGTACCAGTACGCCGCGCTCCACGAAGTACTCTTATCAGCAGCAAGCTCTTTGAGGA
ATACCTCGACCTGCCACTCCGTTTTCACCTGGTGTTTTCCAATCAACTCGCCGTGCACCCCGACTTGAAGCTTACCTCTCTGACAGCCTACATTCTCCCT
TTCGCCACATATAAAGAGCAGCTCGCAGTTTACGCATAGCTCTAGACTATGCCTTCCTTCTTGCAGAGCCTTTACCAGTGCCTCGACCTTCTTCCGTCGC
AGTTTCGACAGAATTTTGTCCTTGGGGTCGTGtagcgtctgcagctgctcagGTGTGCTATTGCTGGCAATCTTGGCAATCGTGGCGTCCGACAGACACC
CGAAGTCCACGCGCAGCAATATAAAGTCTTGCAAACGGCCTGAAATGAAAGCGACACACTCCTCAACGAGTTCTTCTATCTGAAGAAACTCGGAGGATAC
GAGAATGGACGCAATGTTCTCGAGCGTGATGCGAGGACGCCACTCGTGGTCACGTTTATGCATGTACTCCATCAGTAGCTCGAAGATCTCGACGTCACAG
TGCACCGATATGTCGATCTCATCGTGCTCGTTGGCCTCGTTCAGGTACGCCTGGAAGTACTTCATTTTGTCTAACAGCACGTCGCGCTGACACGTAAACT
CCTTGCTGCTCTTACGAAACTCGTCGAATACGTGGATTACCACGTTCcgcgaggacgaggacacgGGAGCAGCATCAGCGGCAGCAGTGACGGACGGCCT
GGTGGTCGACTTCATTCATGCACAATGTGCGTCGTTTGGTGCAACTTGAAGGATCATCACTCTTCATCGTGAAATGATTGCAACAACATGCATTTAATTT
TAGTATAATTTCTTATGAGCATTGTAGCTGTCATTTCAATTGTGGGAAAGGCTGTGAGGTTTTTCGTCATTGTAAGTAAAACCTCTTTCCGTTTGTATTT
GCTGGTTTTCTTTCATGAATGTGGTCCACACTCAACTTTATTGGCCAGTACCGCGCAACCTTCGAGAAGGGGAAACAAGGAAAGAAGCCGCGCagctctc
gagctccagccCCTCCGAGCCCCGTCCAAGCagatccacagcagcagcagccaacatGTCGTTCCCCGCAGGAAAAGCACCAGAACGCAAGAACCTTTTC
AAGAAGGGAATTGACGCCGATGAATCGCGTCGCAGCCGCATGGAAACCACGGTGCAGATCCGCAAGACCATCAAAGAGGACCGCATGAACCAGCGCCGCC
GTATGGTACGGCAATACATACACATCGTCTGTAAAGACGAAGGGGACGATTGCATCATGACTGGGCAGAACTTCTGCTTCCTTAGAGAGTTGGTCCAATC
CGAGAGTCGCCTTCGTATCTTACACTTTAGGCTCTTATCGGAGTTAGGAGGAGGGCTAACTTGTTGTCCATTGTCGATATATAGGCGCCTGCAGACAACG
GAGCAGTCTCTGCCTCGATGGATGCTGCCGGCGAAATGACGCTGGTGCAGCGGGTAAGTATTGGATATACACATACATAGGAACTTGCAGACTTAACCAT
TACGCTGTtgtggaactgcagctgTCGGAGCTTCCGCAGATGATGGCAGGCGTGCAGTCGAGCGACGCCGCTGTTCAGCTGGAGGCAGTGACCAAATtcc
gcaagctgctgtctATTGGTGAGCATCAGGTTACGATTCGAAGAAAGACTGTTGCTAACTTTTGCTATTTATTCCCTGTTCTTTTCCAGAGCGCAACCCG
CCTATTAAAGAGGTGATCGAGACGGGTGTTGTCCCTATTTTtgtgcagttcctgcagcgCGAGGACTTCCCCACGTTGCAGTTTGAAGCCGCATGGGCTC
TGACGAACATTGCGTCGGGTACTTCTGCGGATACCGAGGTGGTGATCAACCACGGTGCCGTGCCTATTTTCtgccagctgctgctgtccacgaACGATGA
TGTGCGCGAGCAGGCCGTGTGGGCTCTTGGTAACATTGCTGGCGACTCCATCGAGTGTCGTGACATGGTTCTGCGTTGCGGTGCTTTGCGTCCGCTTATG
CAACAGCTGATGGAGAACTCAAAGCCTACGATGCTTCGTAACGCTACATGGACTCTGTCCAACTTCTGCCGTGGCAAGCCACAGCCGCAGTTTGACTTGG
TGGCCCCTGCGCTTCCCACTCTGGGTCAACTCATTTATAcccacgacgaagaagtgCTGACGGATGCCTGTTGGGCTCTGTCGTACCTGTCCGATGGctc
gaacgagaagatccagGCTGTGATTGAAGCTGGTGTGTGCCGGCGAATTGTGGAGCTGTTGATGCACCACTCTCCTTCCGTGCAGACACCCGCTCTGCGC
ACCGTCGGTAACATTGTGACTGGCGATGACGTGCAGACGCAGGTCATCATTAATCTGAATGCTCTGCCGTGCCTGCGTGCTCTGCTTGAGAGCCCCAAGA
AGGGCATCCGAAAGGAGGCTTGCTGGACGCTTTCCAACATCACGGCCGGCAACCGGGAGCAGATCCAGTTCATTATTGATGCCGACATTTTCCCGTCTTT
GATTGGCTTTCTGTCGACGGCCGAGTTTGATATTCGTAAGGAAGCCGCGTGGGCTGTGTCGAACGCTACGTCTGGCGGTTCGCCTGAACAGATCATGCAC
CTTGTCAGCCTTGGTAAGAGAGTTGCAGCATCGATGATCCTTGCGATCTTTGTCAGAGAACTAACACGTTCTCGTGTTTACAGGATGTATCAAGCCTCTG
TGTGACCTGTTGGAGGTCAAGGATGCGAAGGTTGTGATTGTGGCTCTGGAGGGTCTCGAGAACATCCTGCGTGCGGGTGATCTGCAGAAGACAGGCGACG
TCAACGAGATTGCCACGATGATTGACGAGGCGGACGGTGTGAACAAGATTCAGGCACTGCAGTACCATGCTCACGAAGGTGCGTCCGACCCATTTTAATG
ATTCATTGTGCTTGTACTTACACGTAGCTATGCTCAGACATTTACGTGAAATCTATGAAGATTGTCGAGGCATTCTTCAacggcgaggaggacgcaGAGG
ATAGCCTAGCGCCCGACACGGACGCTAAcgcccagcagttccagtttGGCACATCCTCGGACCAGCCCACCATGTTCCAGTTTGGACAGAACTGATTCAA
CCAGGATCGACGAGGTAGACAGTAACGGTTTGAAATGGACCATTTGACGGACGCAGGAGGAACACCGCAGGGAGAAAGTATTCATTCGAAATGTATTTCC
CTGTTTGCTTTTTTTTAGTTTGTCACCACTCTTGGAAATTTTGCAAATATGTCAAAGTTCAAATTTGTACGACGAGTGGTCGTACAAATTCAGGTGTAAC
AACCCAATATAGTGTGTACCACCCACTACGCAACCTGCATCGCCACGTCACATACACGTACACCGTTTGCGCAACATCAAATATTGGACGCTGAGGACGA
GTCTCCACTGCAAGAAGTTTCCTGAGCTGCTTACAGCGCGAAACTTTCGGCGCCACTCGCACTCTCCAACATCCGATACCTGTCCAACATGGTGCACTAC
CGTAGCACGCGCGGCGGCGTCCGCGGCCTCAGCTTCGAGCAGGCCGTTCTGACTGGTCTGGCAGCCGACCGTGGCCTGCTGGTGCCTGAGGATGGCGAGT
TCCCGACGCTTCCGGCcgacgcgctggagaagtgggCATCGCTGTCATACCAGGAGCTGGCAGTGGAGGTCATGGGCCTTTTCATCGACGAGAGCGAGAT
CTCGCGTGCCCAGCTGCGCTCGCTCGTTACCAAGAGCTACAACTCCACCACGTTCCGAGCCGAGGAGGTGGCGCCTGTGGCCAAGGTTACGGACCAGATG
CttgtgctcgagctcttccacggCCCAACGTTCGCCTTCAAGGACATCGCCCTGCAGTTCTTGGGTAACCtcttcgagttcttcctgcaACGCAAGAACA
AGGCGCTGCCTGCTGGTGCCCCTAAGCATCAGATCACCGTCGTGGGGGCAACCTCGGGCGACACGGGCAGCTCCGCCATCTACGGTCTGCGCGGCAAGGA
GAATGTCGAGGTTTTCATTCTCTTCCCTGAGGGTCGCGTGAGCGCCATCCAACAGCGCCAAATGACCACGGTGCTGGACCAGAACATCCACAATGTGGCC
GTCAAGGGCACGTTCGATGATTGCCAAGCCATTGTCAAGGACCTGTTCGCCGACGCCGACTTTAAGGCCAAGTACCACCTGGGCGCTGTTAACTCGATCA
ACTTCGCCCGCATCCTGGCTCAGATTGTCTACTACGTGTGGGCCTACTTCCGTGCTCGCGAGCAGGGCGTGACTGGCGAGgtcgccttctccgtccCCAC
GGGCAACTTCGGCGACATCCTTGCCGGCTTCtacgccaagaagctgggTGTGCCCATTGGCAAGCTGATCGTGGCTACCAACGAGAACGACATCCTcgac
cgcttcttctccacgggCAAGTACCATCGCCGTGACATCCAGCACACGATCTCGCCGTCGATGGACATTTGCGTCTCGAGCAACTTCGAGCGCTACCTCT
TCGCTCTGTCCGGCGAGAACCACGATGTTCTTCGCGGCTGGATGCAGGGCTTCGAGCAGACTGGAGAACTCACGATTTCGGGTGAGCTGCTCGCTAAGGC
GCAAGACGAGATGGCGTCGTACGCTGTTCTCCAGACGGAGGTGCGCACTACGATTGCCGAGTACAAGAAGATTCACAAGTACCTCTTCGACCCGCACAGT
GCTAtcggcgccgctgctgctatGCACTTCGGCCAGGACAAACTTGCTGACAAGCCCAACGCCGCAGTGGTCGTCGTTGGTACTGCCCACTACGGCAAGT
TCCTTCCCGTTGTGTCCAAGGCGCTTGGTGTGGCTGAGACagagatcgagcagcacccGATTCTGAAGTCGCTGGAGTCCCTCCCGACTCGGCTAGCGGT
CGCCAACAACTCGAAGGCTACTGTGGCCGAGCACATCCGGAAGACAATCGCCAAGCGGAATCAAAAGGCCAGTGGCAACTGCTTCAGTGCTTGGGCATCG
GCTCCTACTGAGTGCAAACTTGCCACCGCTGCGCTTGCGGTTGCAACTGTTGCGGCTGCCTTCTTTGTGGCTCGGCGCTCGAAGTAAATAGCtacgcagc
aacagcatgcAGCTCTACTGTAAGCAGCAGTGCATTACAAGTCTAGCGATGAGAATTTACATAGAAAGAAGCAACATATCAACGGAATGACTTTGACGGC
TATTTACGTTCCTACCGACAAAAGCCTGTGCGTACATGGCACCTTTATCCTGCCTAGAAGTAGTTAGAAGTCATGTCCAGTGAGTGAGCCTGCTTCTATT
CGACCCTGTACccttcgtcttcaccttTGAAACTGTTTCACATGCTCGTAGACTTGTTCTCATCTAGCGCTGGGTCACGCAGAGTCCGCGACAGTGTTGG
CTTGGCAGTGAACCAGTCGACGACTAGCCTGTAGCCTGATGACCACGAAGCAAGCCGTTCGACATCTCCCCGATGACTACATTATTGTGCAGTTGCTTAC
ACAGACCCCGCACTGGGGTGTTTGATTCTGAGCGAGATACGCCTTCtgatgctgcttctggagGCTCTCGCGCGTCACGGTAACGACGCCCTGGGGGTTG
CTCTTGGAACCATTACTGGGTGCTCGAAAGCTCTGCTGAGAGGGCTTGGCCGGTTCTTTCGGCGCAAACGAGATCCGCTCCTTAGTGTATTGGTTTTCGT
ACGAGTATTCGCCGGGTCTGGTTCTTGATAGAACGCGTCTCCATCCTGGGGGTAATTTCGCAATCTTCTTGGGCTCTGTGGGCGACAGTAGACGCCCCAC
TGGcacgatgagcttcttgaaggcGTCCACGACGTTGGTCGAGTCCAAAGCGGACGTTTCGAGGAACTCCATCGAGTGTTTCGCTGCGAATCGCGCGGCT
TCTAGTGTCGACACCTCTCTACTCTCCGGTAAGTGCGCGAGGTCGCATTTGTTGCCGATGAGGATCAGCACGAGACTCTGGTGTGAGTGCTCGTGCACTT
GCGCGAGCCACCCTGTAACATGCTCAAACGAGCTTCGGTTTGTGATGTCGTACACGATCATGGCACCTACAGCGTTGCGGTAGTAGGCTGCAGTGAGCGA
CTGGAAGCGCTCCTGCCCCGCAGTGTCCCAGATCTGCGCCTTGAGCCGCCGATCCCCGACCCTGATCGTCTTGGTGGCGAACTCGAAGCCCACCGTCTGT
ACACTATGCGGCATgtacttgttcttggtgaagcGCATGACGAGGTTCGACTTGCCTACACCTGAGTCGCCAATTAGTACGACTTTGAGGATGGATTCGG
CCATGGGCGACGAGGCAGGAGATGAAAAGCGCGGACTGTTGGACGCCGACATGGAGGAGCCGGCGACCGAAGTCTTGCTGGAGCCTTGAGCCGCTGGGCT
GGACGCGCTCTCTCGGCCGCCACTGAATTGCgtggagctgatggagcGCCGCATGTCGTGCTGGCGGAAGACCTGGTGCTGCGCCACCTCCTTGGCCGAG
ATATACTGCTGCAGCGGGTTCCCAGACGTCACACTGCTGTTGTTGCcagacgaggacgacgtcgtggtcgtggaggacgccggcagctcgtgcttgCCGC
CCGTGGTCATGCTGGCGAGGGAGAAGCGAAGATCCGAAGTGGCAGGCgctcgacagcgacggctCGAGACAGAGCCGCTTgaagagaagagagaggAGAG
TCGGTTATGACTCAATACAGTAGGGCGGAACAAAGCCTTATTGCGATGGGATGATCTTAAACGAGGCGGCAACAGAGAGAGTGATATGTGCAATCATACA
AACACATTGAGCAGAAGTGGAATTGAATATGGGGTCTCATATAACTTGTTACAGGTATCATTAGATAAACAAATGTAGCAGAGCTTTGGTTGCATGACGT
CTCGGCAGAGGTTATGGCTTCAGGTAGCCATTCCCATCTCCGAAAAGCTTCTGCTCTGATGGCGGCTAAGGGGAAAAGGAAGGCTGATGCAACGTCGAGC
AGCCCTCCCAGAGCCAAGAGGATTACCCGCTCTGCTGTAGCTACAGGTGGGTCCCGGGCAGGATCTGCGGtgagctgcaggaagatcGTGGCGTTTCTTC
GCGGAGTGAATGTCGGGGGTCGCGTGCACAGCATGAAATCTATCGCCGGAGCACTACAGAAGACTGGGTTTCACAATGTTGAGACGTTCCTTGCAAGTGG
AAACGTCATCTTCGACGCACCTGCTAACCAGGAAGGAGACGTACTCACCACCGAACTCCGAGTCGAGCAAGTGCTTGAGAAACTCTTTGGCTGTCAAATT
CCAGTGATTGCTCGCTCCATGGAGGATGTGGCTGCGCTGAGTGAACAGGCCGTGAAGACCGCTACGGCTGTgaacgtggtgctggtgaagaaggaTCTGA
CCAAGGAGCAACGAGATATCGTCTCAGCTCTCTCTACTGACACTGACGAGCTCGAACTTCTGGACAAAGCGTTTGTGTGGTACTCCGCCACCAAAATGAG
CGAGTCTCCGCTGTTCAAAGTGGCCTTCGACAAGAAACTGGGTGTGCCAGTCACAGTTCGAACGGCGAACACCTTGCGCCGAATAGTAGCGAAGTTTGGC
TAGCGTGAAGTAAATTGTAGGGCAAAACTACAGTAGCTTAACCCAGTTTTCGTATGATCTTTCTTCTAAGGCATATCGACTGGGAGTCTCTCTCACTGGT
TGCTCCATCGTCGCTTCATTCTCGACACATACCAAGCTGCTCGCCTCGCCCTCGGACATTTCACTTAACATTTCAGCATTGTCAGCTTCTAACGTCTCCG
TGACCTTTTTTTCTGTAGACCTCTGCCCTTCCTCGTCATTAACTGCGTAGTTGCCCGGTTCCTTTGCAATCACTGTTGGGTCTGTTGCTTTCTCAGCGTC
ATCACTTCCCTCTGCAGCTGCATAGGTGTAAATCTCTGGAGGTACTGGAGTGGGCAACTCGTTAATCTCCATCTTAAAAACCTGagcgagaagctgaacg
ccTTGAACTTCTTTTCTCGAAAGCAGCGTAACTGCTAATCCCTTCCCACCAAAGCGGCCGGTTCTTCCAACACGATGCAAGTATGTTGCTGGGTCCCGCG
GCAAGTCCAAGTTCACCTGTGATTTCATAACATGACAATGAGAAAACAGATTTTCTGGAGCACAGTTAAATTCCTCCCAACTTACCACAAAGTTTACTTT
GTCAACATCAATTCCTCGCGCAGTGAGGTCCGTCGACACCAATACACGAGAGCGCGAGGCTCGAAATCCTTCCATCACTTCCAATCGGGTAGCTTGAGTC
TGAGATCCAGTGATacatgctgctggccagCCCTGCGCTGTTAGAGCTGCAGCTAGCGCCTCGGCACGAAACTTGTCGTTGCAGAACACCATGCACTGGA
CAAACACGATTTCCGACAGGAGTACTGCCAGCTTCACCACTTTTCCTTTCATATTCAGGACGTCATCACCTATCACTGGACCGGATGGCGCCTTCACAAC
ACTATAAAACTGACGAACGTGGCGAAGCCATAGCTCCGGCGCATTTGCCTGCTCTCGTTTCTTCAAATTTTCGAGATCTTCAACGGACGAAATAAACTCT
GTCGTGACATCATCTAATCCTCGAACTCGCACGATCTGCTCAATAAAAAGTTGCACGAAACTTAGTACATACACGCACACGTACGTTTTACTTCAATCTA
CACACCTGTGGAGTACTCATGAGCTTcgcgacagcaacaagctgATTAGGTGTGAATGTGGCTGAGAATGCAAGAGTCTGACCAAGGTAAAAACAAACAC
ACACACGCACAATAATTGCGCGTTAGCCAGTATCCCAGATCTGCCGTTAGAGTAGCGCTATTACCTGTCGTCTCTCAGGGAGTGCGCCCGTGATGTACTG
GATCTATAGCACAGCAAGGCTGTCAATACCAGTTCCGGTCACTACGGCTTTAGACCAATGCACGTACATCTTTCTCGAAGTCGCGCGCCATCAGTTTAtc
cacttcatccagcaccagcagtcgAATAGAACTACACGGCAAAGAGCACTGGCCCACGAGTGCTTTCACGCGTCCTGGCGTGCCGACCACAATATGACAC
CCCGCTGCCAAGTGCATCTACTCAAAACACCACCCAGTCAATATCTATAGCATCAAAACAGAGACGCATGCACCCCTAGATACCTGGTCTTGAGCTACGG
ACAAACCACCGATGCACGTGCGGATGACAATGTCCGGCCGGAACTGTGCCAATTGACGCAGCACAGTCTCAATTTGAACTGCGATCTCTCGCGTTGGCGC
CAGAATCAGAGCTAATGGGTCTCCCACTACAGTGCCCTGGCCTCGTTGCTCAATGTTGCGGATCGCGTGCTCGATGGCTGTGACTCCGAAGACTGCAGTT
TTGCCTGTGCCGGACTTGGCCTGGCCAATAGCATCGTTGCCAAACAGAGTCACGGGTAGCGCATGCAGCTGGATGGGCGACGGACGCAGGAAGCACATAG
TTGTAAGTGCACGCTCTACATCTCTGTGCAATGGTAGGTCGCTGAATGTTGTCGTACTGGCAGCTAGCGCCGTGTCTGAAGATTGCACCATTAGCTTAGA
CCAGCAGTGCCACTAATGCTTGAGTCCGGGTCAAGTAGAATTGGCTAGTGCCACCGAAATCGAAGCCATTTTAGCTAAATGCAGTGCATTTAATGTACTG
CATTTAGCTAATGTCGTATTAAGGTTAACCTTCTGTGGGCTGCTCGTTTGTAGTAGCCTCATTGTTGGCGACAGGAACACTGAGATCCACATCCTCTACG
AAACTTGCTGGGAAGTAGCCTTTCGTGCCGTCGCACGTTTCCCCGAGCCACcaatcaccaccagcttTTGAGAGTACACGGATGATCTCTCCACGAATCA
AGCTCAACTCATCCGGATTCTCAGCCGCGTAGTCATGTGTCGCGTGTACTTGAATAGGTGATGGCAGCAGGTCATCTACATCGGCATTGCTTCGATAGTT
GGTACGTCGCTCTGGTGGTGAACCTTCTTGGAGTTCGTTTTCTGCCGTGTCGGTTTTCAAGTCCTCACCATCCATGTATTGAGGCAAAATGTCACGGACT
GGACTagcttcctgctcctcaCTCGCAAACTGATCGACTCGAGGTTCTTGCGCACTGTCGCCCTGATACTCGTAGTCTGCTCGCTCACGATATTGCCGAG
AATGTTGTCGTGGAGAGAGCTGACCTGACCGTTGTTTGTCACCCTGCGGAGGAGGTATCGGATTCGAGCTAGGCCTCAGCTCTTCGAtggtttcttcttc
tgttaGTTGTGCTTGGGTTGTGCTTTGGGCGCCAGCTTTTGCTTCGACCCGTGTTGAATTCGTACCCCCAACGTCAACTTTCCACTGTATGAAAGTCCCG
TCGCCAACAGTGATTAAATATGAATCGTCAAATGAAAATTCCAATGCTGTAATTGCCGAAGAGTGAGCCTTAAAAGTTTTCCTTTTAGCACCGCGATGAG
CTGGGTACTTGAGAAGTTGAACACTAGATCGACAAGCAACAGCCAGCATATCTTCACTGGAGTGCAGGCTTTCTGATTCATCGAAGCTGTTCACAGTTTT
TGAACCTGTAGTGCAGACACCAGCGATATCCACAATGTTTGGTGATTCCTCTGACCAAATCCCTGGCGTAGGCCATCCAAATACACACGTCCATTTGATC
CACTGCACGTCACGCACTAGAAAAGCGTCGGTAATCTGCTTAGTTTCGCCCTTTGTCGAAGATACTAGCCAATGGAGAATTTCGCCGTCCGCCGCATTAC
TTTGTAGAATATCACCGTCCATATTCCAGGTCAAATGCATCACAGCGCTTGAGTGGCCTTCGCAAACATGGAGCTTATTGTAAccgttgacgacgtcgtA
TATGTAGACGAAGGTGTCTTTGGCCCCAACTGCTAAAAAGGTAGCGTTTGGACAGTACTTTACAGCAGCGATTGATGTACTTCCAGAGTTTGATCTGATA
CTCTTCCGGAACAATATCGCAAGTCTATCACAATCCACAACCAGAAGTTCACCTGAGCTTAGTCCAAATACAAGTTCGTGGCCAGTGGGGTGGAATTCCA
TACAAAAAGGTTTGACGCTGGGTGTAATGAAAGTTCCAAGATAGAGGCGACGTGTACATACGTGCTGTTCAAGATCCCAGAAGCTGAGGTACCCATCTTG
AGACAACGTTGTCACCTCTGGGATTGTTGGATGTGCTGCGCATGTTACCATGACGCCGCTGCGGGCTTCAAAGAGTAGCTGCCATTCACCAGATGCGATA
TTAAGCTCCCAAAGACAACTGTTACTCGTGGCAACAAGCACCAAGTTGCCATCTTCTTTCCAGACGATACTGGTGGGCTTGGGTGTAGGAGCTGCACCAC
CTGCGCTAACTTCATTTGGTAGTGCTGAGGGCAGCCAAAACACTTTTACTGGATCATCGTGAGGAAGCAAAGCGTGCGAGCCTTCTGAAAAAGTTCCAGT
CAGTGGTGTAAATACTCCTTGCGTGCTGACTCCTGGAATTCGCATTGGCTTGACGATCTGACACGTCCACAGCAATAGTTTTCCATCAATTCCACACGAC
AAGATCATATTTAGTTTCTTTGAGTACGCAACTTGGTAAGCTGCTCCTTGATGAGCCAGCGGGCCGCTATATCTCAATTCATCTAAACGCGAATGCAAGG
TAGTTGCATTCGGCCGCAAAACCATTATCTTTGACAACCCCTCCATCTCAGTCTGAGTTTGCCTTGGCAACTTAAAGCGATTGCCAGTTTCTTGATCGTG
CGGCACGACATCAACGAGCCTCGCAGTCGGCTCGTatgcgatcttctccagtacaaGATCATTGATCTCAGCATCAGTGTACTCATCTGGAATTTCCCAC
CACTTTGCAGGCTCTTTTAACAAGTCACTTTCAGAAATGGTTTCAATATCTGGGCTTGCTCTTGGCTGCAAGAATAAGCACAAATCCCCTTTAGCCGTAC
CAGCTATTATCCGGCCAAGCGAATGATCAGTGGCATTTGTCGCAATCAACTCCTTTGAGTGGTCATCATACTTGtaaagaggaggagaatCATTCACGAA
CGTCAAACTTGTAAAATCTTGAATCTCAAAGCGACCATGAAATGAAGGGACATTGCCTTCCAGCTTCCACACTTTCTCGGTTGGTGTTGGAGGACGTAAT
CTTGGTGGGCCTCCAAATGTGGAGCGAGAAAAAGCACTGTCAACGTTTTCCTTTGAAGTTTGAGCATAGTCTGCTTTTGTGAGTGTCCAAAACCGGATAT
GCCGGACACCGCAGCTCACCAAGGTGTAACAAGCATCATCATCTTGCAAAGCTTGGCCTGGCTTCTTTGACCGATGCGTTTCAGGTCGACCATACGCTTG
GAATGGATTGAAAGCAACTGTATTTACGCGAAAGGTGTGGCCTCGAGCGCTAACCAACATCTCTTGAGTTTTCCAATCGTGAATACAAATAGTGTTGTAC
ATGTCCCCACCCAGAGAAGCAAGCAGCTTGCCATCGTGAGAAAAACTAATAGATCGCACAGCGACTTGATGACCCTTTAAGCAAGCGAATCGTTTACCCA
GTGGTTCATCATTGGCATTCCATACTAGAAGAAACGCAGAtcgtccagcttgtcctGATGCAACGATGCGCTGATTGGGATGAACTGCTACACATGTAAC
TTCGTTGGTGTGTTCTCGGAAATACCTCTGCGTATTGTTTTCCTTCTTGTATAATATCACCAGCGCTGCAGTGAACCACATAATCTCGCCAGTCGATAAA
TAGAATGCGCTGTTGTTGGTACTTGCATTAGGTGCTGCGGGATGGCTAGTGGACAACGATGTGGTGGCTCCACTACGGCATCCATACACGAAGTCCAGCT
GTAACGACGCTCGTGGTGCCTGAAGATCTGAAGTGGAAGTTACTTCGCCATCAAATATACTAGGAGCAAACACATTGCTTCGGCACTGCGGATACCGCAC
CAGGGCTCGTTCGTACAtctgctgccgttgctgggATAATACAATTTGTGCTCCATCCGTGCGCTTCTCGATATTGGCCACACGAGGAAGTATCTTGTCT
GTCGAGCAACACAACAGTTAGAGCATCGCAACAATTTCCCCTCTCGAGGACAAGGCTGCAACTATAATTCATACCAAAAGTGATTTTGCCATTAGGGCTG
CGGGGGCCTGGCAAAAGAGCCCCTCCGCTAGCATTTCGCTTCATCTGGTGGATATTCTTGAGCATTCCCCCGCTAATCCTAACAAAATACAATAGCATCA
ACTTATCCGTAGCAGCTATGTAACTAGAACCCGCTCCACGTACTTTGGCAGCTTCGGTggggaagacgctgctggcggaACAATGTCGAAAGGTGTGGTG
ACCGGATGGATGTCGAAGGGCGACGCCTTTGGGGTCGCGAAGGGTTTCTTCTTAGTAACACTGTTGGACCACGAGCGCTTGGAACTGACAGTTGCCGCCA
TCTCCTCGAACTCGGCCAGCACTTTAGCCATTTGTTCTTTCATGGCTTCCAGCACGGACCCTCGCTCCCGCAGTTGACGTTCCACCTCGTGCGAGATGAG
CGATGTGAGTTGGTCAGGTGCCACACCACCGTCGCTTTCACCTAAACAACGTGTCAGTAAGAATCTATCTCTCATGTATCTACAGACagacagcagctct
tcctcactcATGGCGTCGCTCCAATTAGGGACTGGCCCGCCCAAATTTTTTGGTTGAAGTAACGCCTAGAGTGATGGTCTATTTCATGTGGTGCACATTT
GAACCcgagatcttcttcgtcactcaCTTTCATTCTAGCGGGAAACAATGCGCGTGAACGAGGACAAGATCGCGCAGTTGCTGGACAAGGTGCGCTGTTT
AACGCCATTCAGAGGTCTACATTGACATCTAATGTTTGTGTGTACGCCCTCAGACCACGGACTTTGACAAGGATGAGCGCTACATGGCCACGTCGGATCT
GTGCGTCGAGCTCAACAAGGACGTCGACCTGGGGCCGTACATCGAGCCAAAGTACGTGCCTAGCGCTTAGAACCGAGAGAATGTATGGCCTACTGACGTA
TCTACAGAGTGTGTGCTgcggtgctgaagcagctggacgatAAGTCGAACGACGTCCAGTCCATCGCTGTGAAGTGCTTGGGCATCCTGGTTACCAAAGT
GCAGCTAGCCCAGGTGGCGGATATCTGTGCGAAGCTTTGCGACCTTATTCTCAACGGTAAACCGGAGCTCCGGGACATCTACTCGATCGGCCTCAAAACT
ATCGTAGCGGACGTGTCCCAGGCCACGGGGGCGTCCATCGCTACAGGTATTTGCACGCGGTTGCTCACGGGTCTGagcaaggacaaggacgcgGCTGTGA
AGGCCGAGACACTGGATATCCTCACAGATCTGCTGCGCCGCTTTGGCTACGACGTCGCTACTGAACACGCGACGATCATGGAGTTGCTCATGGTGCAGCT
CACGGACGAGTCACCGCTTGTGCGCAAGCGTGCCACGGCTTGCGTGGGATCACTAGGTGTTATGGCGTCGGATGTTCTGGTGAGCCGCTTGGTGGAGCAC
CTGATCAAAGGCATTCAGGGATCTTCCGACACAGCGAATGTCCGTACGCTGATCCAGACGATCGGCATGCTCTCGCGCACTGCAGGACACCGTCTCGGAC
AGCACTTAGATGCGGTGATTCGTATTCTGGTGCAATTCTGTGGAGATCAAGAGGACGAGTCACTGCAGAATGAAGACTCAGATGAGCTGCGTGGGAACTG
CTTCCAGGCTTTTGAAGCATTTATTATTCGATGCCACAACGAGATCACGCCTCACATGGACTCTATTATGAAGCTTGTGATGGTGTTTATTTCCTATGAC
CCTAACTACAACTATGTGGACTCTGCTGATGAGGATGAAGgcatggaggaggaggaggaggagtACAGTGATGAGGAAGGCGACTacagtgatgacgatg
acacgagctggaaggTCCGTCGAGCTAGTCTTCGTGTTCTTACGGCAGTTATTACGACAAGACCCGAGCTTCTGGAGCAGATTTACATTCACTGCGCGCA
GACTTTGATCTCGCGTTTCAAAGAGCGAGAAGAGAATGTTCGTATCGACGTGTTTGGGGTGTTTGCAGAGTTGCTCCGTGCTACTCGAAAAAATCTTCCG
AGCACAAATGGAACTGGTTTCTTCCACCCACCCACATCGAACGCGTGTGTCACACAGCTAGAGCAGCACCTGAACGCTCTTGTTGTTGGAGCCAACAAAC
AGTTTGGAACGAAGGCCTCTGTTCCGTCGCGATGCGCCGTCGTTGCAATGTTGAGCGAACTTGCGATGGTGGAGCATGGGAAATTAGGAGGGTATATCGG
TCGTTTGATGCCGAACCTTCTCAGTGCAGTGGAAGACAAGCACTCTGACTTAAAGCTGGATGCGCTTACGTTCCTCCGTCTGCTTGTGGATACACACACA
GTAGAGCCATTCCGACCGCATGTTGATTCGATTGTCAAAGTTGCTGTTGAATGCGCAAAGGGAGACTGGTACAAAACGGTGGCAAAGGCTCTCGGATTGA
TCGAATCTCTCGTCCGTATCATCCGTTCTGAAGATGGAGATCCGACGTACAAGCCATACGCGAAGCCTTTTTTCGAAGCGGTGTTACCTAGCTTAAAGGT
TCATGACATCGATCAGGAAATCAAAGAGGCTGCGATCAGCAGTATCGGAGAAATCGTTGCTGTCCTGGGTACGTGCATTGTTACCGTAGATTGTTGATAA
TAGCTAACAAGTGCTGCGTTTTGATGTGGCTCCAGGAGACGAGCTTGGTGCACATGTCGGGGAAGTTTACCCACTGCTGATGGAGCGCCTTAACAACGAA
ATCACACGAGTCCAAAGTATCAAGGCCATCGGAGTCATTGCTCGCTCAAAGTTGGACTTGGAGATGTCTTCGATTCTCGTGGAGTGCACACAAACGCTAG
CCCAGCTACTCCGTCAGCAGTCTCGAACACTGAAGCAAGCGGCACTGGCTACACTGAATGACCTAGTCGTTCATAAGGGCGAGAGCATGCCGGAATCTTT
GCACTCCGAAGTATTGGTGGAAACCTCGCTCCTACTTGTTGACATGGATCTTCAGCTATGCCGCTTGAGTATCACGTTGGTGTCGAACTCGCTTCGTGTA
TGCCCGCATGTTGCTTCATCGgatgcgctgctgcagaacgctcaagtgaaggcgttggagctgtgcCACAGCTCCATGCTTCAGGGTCCCACGTTAGATG
CACTGAAGGGCCTCTTCGCTCAGCTGACGCAATTGAATTCCCCTGGTAGCAGCTTCACAGATTTGTTCAAAGCGTTGATGGCTATGCCTTCTGAAGAATC
CAAGCACTCGGTACTGAACATTGCTCGTTGTGTTGCTGGCACATGTGTGGCTACGACGGAAGAAAACCGCAAGTTGGCCTTCGCAAAATTTGTTGGCGAC
ATAACCCAAACAGAATCCGAAAAGAACAAAGTCCTGGCACTTTACTGCCTGGGCGAGTTCGGACGCAAGATCAAGCTTGCTGGCTATACTGACGTGAAAG
AGCTCATTCTAAAGTGCTTTAACAATCCGGGTGAAGAGGTcaaggctgcagctgcgtaCTCGCTTGGTAGTATTTGCGTCGGCAACATGGAAGAGTATCT
GGACACCATCATGGTGAAGCTAGAGCTCGGAGAGAACTCTTACTTGCTTCTGACGTCATTGCGTGAAGTCATTTCGGATCATGCAGCAAAGCCGCACCAT
GGTTTTGCTATGTATGTGGACCGGGTCCTTCCAGTTCTACAGAAGATGAGTGCCCGCCAGGAAGAGGGTGTGCGGAACATGGTTGGTGAGTGCATGGGAA
AACTTGCCGTGACGGACAGCGAGAAAATCATGCCGATTGTGACGGAGCTATGCGGATCTTCAGACGTGTGGTCACGTTGGACTGCTGTGACGAGCCTTAA
GTATGCGATGACGACCACGGCCCAGCAGCCAGCAGTCAACGCCATTTTCGCGCACATTGACCCCTTTTTGGCtgcgctggaagacgaagacctgCACGTG
CGTCGTGCCGCCCTGCTAGTTCTCAACACGGCTGCTCACCACCACGCGCACTATCTGGTGCCATACGTACGAGGCCGCATTTTCCCCGTGCTTCTGAAGG
CGACTGAGATTAAGCTGGAGCGGGTTGTGGATCTTGGTCCGTTTAAGCACAAGGTGGATGATGGCCTTCCTCTTCGTAAGGCTGCGTACTCGTGTGTAGA
TACTTTGATCCAGGTGCTACCACAACAGCTCGACATCAGCCTGTTCCTCGACCAGCTAAAGCGTGGCCTTGGAGACCAGGACGATATCCAAATGCTCAGT
CACCAGATCTTGATCAAGATCTGCTACGTGCAACCTGGCAGTATTGTTGGCGCGCTGGATTCGTTGGTGGAGCCACTAGAGAAAACGATAAACAAGAAGG
TGAAAGAAGACCAGGTTGGTCCTGAAGTCGAGCGAGTCAAGGACCTCATTCGCAGCGCATTGCGTGCGCTTGATGCGGCCAGTGCAGTGCGTGATGCAGA
ATCCCACCCCAGGCTGAATGCCGTACTGGAAAatgcgaagaagaacaagatgCTTGGCCCACTTCTGGAAACAATTCGGAGTGAACGGACGACTAACTGA
GTCGGCTCAAACGTAAGGCACACGGTTATCAGTTGTGCTCAATGAATTACAGCTCATCGTTCGCGGCGAATTCAGCTTGTGTACGCTTTCGGCGACGATG
CTTCCTTTTCGCATGCAAACCCTTGCTAGGCTTTGAATCTTTAGTATCACGGTCGCTTGCTTTCTTGCGGCGGGACTTGCTAGTTCTCGTCTTGTGGAGA
GTGCGTTTTGAGTAAGTATTACCGTTCCATTCGTATTCTTTCACCTCGTGTTGTTCGTCAAGAAACCTCCTGACATCATCGACGAAAACCCCCTTCTGCA
GGCCAACAAGTAATTTGGAGTCAGCGACTTCGTAGATGTTCACCTCGACACCACCGTTCCACAACATCTGCATCAAAGTCCATGTGAGTGTAACTATCGC
TAAGCATTATTGCTatttctacatgtacactcACCTCTTTCCATCGTGATGCAATATCAGGAAGCCGTTCACTGTGTCCGTTCTTCATTGTCACGAAGAT
CATCTGGGGTCCAAGCGTCTTCGCATCCTTCTCGTTCCTGACAATACATACAGAGTAAGAATTCTGTTTGAATTCTTCTACTTAGTCCACTTACTTGTTT
GCAAGTTGTCGATAGCGTTCATCTCCCTCcgtttgcagctcctgctcgtcgtcgccagcttcCCACGCCTTCTCTAGGGCCTCATAGTCAATCGTCTTCG
TGCACCTACACTCTAGAGACTGCaagagaaggccaagcaagagcagcaggaaccACCAGTTCATCGTGGATGGCGCTTCGAGAAGATTTTTTGCTGGTCA
CTTGTGGTTTCGCTCCATATCTATTTCCGGGGTTGCCAGTTGCAGCGGACAAACATGGGCACATGCACTGGATAGCACCATTCCTCGTCGTGCATCGTTG
GCAGACCGAAGTAGCACGGCTCGAAACAAGTGAAGAAACGGTGaagatgagctgcagcctcggAGATCAACGTCACCAGCATGGACAGAACTGTCTACCA
CGGATTAATTCACCCGGTACCTTGTCATCCGGTGGTAACTCCTCAGTGAAGTGCTGCACACAAGCCTGTTTTCTCCGTGAAGAGCAAAACGCGCGAGAAC
TGCAGGTGCATCGAATTGGTACTATGACTCTACGAGGTTGCTAAGTGGCTAATGTGGTTATCATTCGCAGAGACTTCGCGACTCGTACGCTGCGTTAAAA
GAAGAGACAGACAAGGAGATCGGAttcctcaagcagcagcttacCAATGCGTCGTCGGGGTTTTCAACCCCTCCGAAGACTgccccagcagcaaacgATG
ATTTCATAGTAACATCTTCCTCGCCCTACAAAGCCTCCGCCGAGACAACGTCCACACACACACTCGTTCCAACGGTGTATTCCATCACAGACGTAGGTGT
GAAGCCATCAGGACGAATCGATCGTTTGGGAAGTATCACGTCGGCGCAAGTGCTGGCATCACTACGACCTTTACCAGTGCCAGCTACCGGAGGCATAGCT
GCCGCGAGGCGAGTGCTTGCAGCATTGGCAGACCCCATGATAACAACTCAGCCTTATCTGCGTTCTCTTCGCTTTGCAGCCGATCTTGTAGAGCTAAGCA
CTCAAGTTGGTGCATTGCTGGAGACTGAAGCTCGTTGTTTGGGGTTATCTAGTCCGATGTACGTGTTCGGCGATATCCATGGCAATTGGGCGgacttgcg
cttcttcgcggaGAATATTTGGCACCTCGGCCTGGAACTTACCGCTGGTAGCCTCCTGTTCCTGGGCGATTATGTCGACCGTGGAAGCTCATCTCTTGAG
TGCACAGCTTACCTGTTCGCTCACAAACTTCTCTACCCAGGCAAAGTCTTTTTGTTGCGAGGAAACCATGAAACGCGTGCTGTCAACGGACTTGAGGCAC
ACTACGGCTCTGGCTGTTTATTGGCACAGTGCAAGGCACGTTTCGGTGCGAGTGAGGGTGGAGTTGTCTGGCACCAGCTTAACAACGCGTTTGATCGCTT
GCCCGTCGCTGCagtcatcgacgacgacgttttCTGCGTGCACGGTGGAATTCCTCGGCCGATTGACGAAAGTGAGGACCTACTGGAGACGATTGGTAAA
CTGCCAAAGGCGGCAGCTCTAGACACCCTGGACGTTGCGTATTATGCAGACAAGCCGCAACTTTCCATGATCGCGGATATGATCTGGGCTGACCCTGTTC
GAAACGAAGACGCCACGGGGAGAAATGTACGTGCTAGCAACTGGAGAATGGACTCGCATGGCTTTGGCAGAAGTCCGCGCGGCGGAGTTGCGGTACGCTT
TGGGTCCCGAGCAATTGATCAATTCCTTGGACAGTATGGGTTTTCTCGCATCTTACGAGCCCACGAGGCCGCGCGCGAGGGGCTGTCGTTCAGCAACGCG
GCTCGAGTGATCACCGTTTTTTCGACGTCCAAGGATCATGGTCTAGGCGATGATGCTTGCTGCGCATGCGTTCTCGTGGATAATCAGCATCTGCGCTTCT
TCAATCGAGCAACAAGTGCAGGCAGAAATCCTTGCCAGCAAGTGCCCCGAAGGCTCAGTGGCAGCCGAAGCAACAGTACGTCCTGGATCAACCGTCTGTC
GAGTGGGCTGCTGCCAAGCAATTTCGTTTCCAGTAGTAGCTTGCATGAGGCACTTCACCGACAACGGAATGAGCAAAATGGTGATGGGGACGATACAGAC
GATGAGGATGGCAAAAgtagcaacagcagctccattgtTCACTGCACCGTGAGCTCTTTAAAAATCAGCAGCTTTGGCCACGATGGACTATCATCTTCTT
ACGAGTTTGAACAGAACGGCGGTCACGAGGATAACAACCAAGCGGACGATGACTAACACACTCCAACACTTTAAAAGAAACTTGCTCTATTGCCAACGTG
TGATGTTTTTTTTCCAATCTACTAGGTGGTATGTCAGCAAGGGAATCAAATACGAACAGCGAGCTGGGCGTTGCATTCGCTAAGCagttctacatgtagc
aggcATCTAATGAGCGATCAACTGACGAAAGTGAGGCCCTTACTCGTTAGACTTCACGGGCTCCTTGTCCGCCAGCTTAAGCTGCTTGCGCACGCGCATC
TTGAAGTCCGAAATCTCGCCCTGGTACACATGGATAGACTGGTTCTCCACAAGCCAGATCTCCTTGGCGACCTGAGAAATCAATCGCATGTCGTGACTAA
CCAGGAGCATGCCACCACTGAAGTTGTTGATAGCACGGGCCAGAGCATCAATAGACTCCATGTCCAAGTGATTCGTAGgttcatcaagcagcagcatgtg
AGCGTTCTGCTGGGCCATGTAGGCGAACACGACACGACTCTTCTGACCGTCAGACAGCTGGCCCATGATCTGCGTCTGCACCTCGCCGGTAATGCCGTAG
CGACCAAGGTAGCTACGCACATCTTCAACCGACTTGGTCTGAAACAGCGAGCGGAAGTACTCAAGCGGGGTTTTTTCCAAGTCAAGCACGTcgacgaagt
gctggctgaAACGAGCAATACGCAGCTTGCTGTGTGGCCGAACATTGCCCGCAACAGGCACCAGGTCACCCGTGAtaagcttcagcagcgtggTCTTACC
CGTACCGTTGGCACCAACAAGGGCGACACGAGAGTCCAGATCCAGGCCCATCTCGACGCCAGAGTACAGCACCGGGCAGTTCGGGTAACCAAACGCCACA
TTCTGGAACATAAGAACCGGAGGCGGGAGCGGCTCCGGATTGGGGAACTTAAAGTCGCCAATCATTTCCGACTCGACCTTCTCAGTAAGACCATCACGCA
CCATCTTGGCCAACGTCTTTTCTTTACTTTGAGCCTGGCGAGCAAGCTTGGCAGAACCGTGACCGAAACGAGCAATGTACTCCTTCATGTGCTTGATCTG
ATCCTGCTCCCAGTTGTAACGCTTCATCTGGTTCTCCTCCTTTTCAGCCTTCGTGCGAACGTATGTGTCGTAGTTACCAGCGTAGTactcgagcttcttg
ttggtcaAGTCGATGATGTTCGTGCAGACCTCGTTCATGAACTCCTGCGAGTGCGAAATCATGAGCAGAATCTTCTTCCATCGGGCCAGGTAGTCCTCGA
GCCACACGACAGCCTCCATGTCCAAGTGATTAGTCGgctcatcaagcagcagcagagtcGGCTGGATGAAAAGTGCACGGGCCAGAGCGATACGCATGCG
CCAACCACCAGAGAActccttggtcttcttgttcatcaTGGCGTCGGAAAACGTCAGACCAGCCAGAATCTGGCGAGCGCGGACTTCAGCCGTTGCGGCA
TCCATGTCATCCAGACGCTCGTACAGGTCCGTGAGACGGTCCGAGATGGCTTCGCTGTCCTCTTCGCTGATAGACTCATCAGTCATCTGCTCCGAGAGCA
GATCAGCCTCGGCCTGGAGCTTGTTGCGTTCCTCGTCGACAGACAGCACGGCTTCGAGCGCCGTCATGTCGCTGGCCTCAATCTCGTGCTTAAGGTGGTA
GATATCGATGCTCTCCGGGATGGGGATGCCACGTGCGCCCAGCACATTCATGAAAGTCGACTTACCAGAACCGTTACGACCGATAAGACCGTAGCGACGG
CCGTAGTTGAGCGAGATGTCGCACTCCTCCATAAGCACCTTGCCGAAGTACGTGATACTGAAGTTCAGCACGTTGATGTCCTTGAAGTTCTTGTGCACAG
AGCGGACGTTGTGTGAGCAGGTGGCAATGATGCCTTCCTCTGCGAGACGGTCGGCGTGGGACATATTCTCGAGCGCCTCGGCCTTCTCagccgccttctt
ctcctcagcaGCTTTCTTGCGCGactccttcttgcccttgcgCTCACGCTTCACGCGCggttccttcttctcgcgggccatggctgctgtggtgctCCTT
GGGGTTCCTCGAACGACGAAAAGCTGTGCGCCAAAACCACCAATACCAAAAGTGAGCCGACCAAATGCGTGGCGCAGAGGAGGTAAAACCTCGATGTGGT
TAAAACCTCGTTTAACTCTGAGATTCAGTAAAATGACATTTCTAAAGGAATACAAGGGAATCAACCACGTATAAGTAAATTCTATATCCTGCTCAAGTCG
ATAGTAACCTCTCCAATTTGATTCAGAGAAACGATTGGCTGTCTAAGCTTGGCCAATCGCGTGGGTCTACTGACGTgcagatgtagccatctatCCCCTT
TGACAAGTGCGTAGGCTGCAAGGGTACTGATTGTTTGCAGCAGTATTTATTGCAGGTACCACGTTGAAAATGCTGTATATGCCACCGGTTGAAGGTGCTA
CGTCGAATACGATGCCACAGGTAAGCCAAATTCGTCGGTGGCGCGAGCAGACCTGCCGGAGTCTAAAGCGCCCGATGGCGCCGCAGGCAACTCGTGGTGT
TGTGCGGGCGTTAGGTAGGACGGAGCCGCCTCTGCATCCTCTCCTAGTGCCTCCTCATCCGCCCACTCTTCCTCGagtccttccagctctgcttctagtt
cgtcttcgtcgattTCGTCACCAATACTGCAAAAACGAAAGCACCACCATTGTGAGCAGAGCATTTTAGGTGAAAGTTGTACTGGATTGCTGCATTTTCA
GGGTGCACGTACCCATAAGAGCGGCCCATAATTTCCTGGATCTCATTCATGTCCTCCATGAGGTCGGCCATGTCGTCTTGCACGTCCTACAGACGCCCAA
CAATACAATGAACCAATCGATGCCAGCAGAAAACATGTTCCAGCTCTCAACccacctccagctcggaAATATCAATTTTCTTGGTCTCCGCCTTAAGCTG
CACTGCTGCGCTCTTCATGGCGGCCACAGTAGAGATCGTATCTCTTGATGTGTCAATGGCAAATGCCGCCTACACGAGCACAACCATCGTACTTTAAAAA
AAGCCTGGCTTCAGAATCCGCCAAGGTGTTGCAAATATCATTGCTACTCACCTGCTCAATGTTGAAGGACTGGGCCTGCAGTTTATCGCGCTGAGCTTCA
TACATCTTCTTTCGTTTAAGCGTCTGCATGGCTCGCTGTTTAATGGCGTTGACGGCGGGGCCTCGCGTCTTTTTCATCTGCTCGCGATATTTGCGTAGCT
CCTGGTCCAGCTTCTCAATCTGCAGAAGCAACAAGTCAGCACCCGCGGAGCTCCCCGTTCGACTGAACAGCtagagctgcagctacacACCTTCATGTCC
AGGTCAGTGACCCGGGCGTCCACCTTTCCTCCCACATCGGAGACATTAACCTGTGGCGCCTCaggcttcttcttgccgaaAATGCGGTTCATTCTTGAGA
ATCTTGACTGACAGATGCGCAAATGTGTATTTCCAAAGGGAACTATTATTTTGAGACAAATATCCTCTTTTCAGTAAGACTGATAAAAAATCCACTCGAT
TTACTAAAACGATGAAGAAGTTTGCAGTTTGCAGTTGATCTCATTATAAAGATAAAGAAATTAATGAGGCCCCTGGCTAGTTCGAAGCATTTTGTAAATC
CCTCCGTGCTGTTGCTCACCGAACGTGCGTGGGGGTGAACTCTAACAATCAGGAAGAACGACTCAGTTTTGTCTTCATGCCACATATTCCTACGCACATA
CCTTGGATATCGATCGTGCTGCCACCGTCTCTAAAGGGGAATACATGTTATCGTTCAAGCTACCAACTGCACATGGTACCGGCGTGCTTACCTTCGGGTC
TATGTCCATCTTCTACGAGAACTGGTTCCTGTTTCAGCGGCTTATTTTTTAGTAGCAGCGAGTAAATTCCACCATGCCTGGCCTTGCCTCGGACTTCTGG
TAATGTTGGGAGCGATGACCTCGTTATTCTCGACGCAGCTCTGTCAGGTACGCAATTTCTGTAGTTTCTAGGATTTGGTGTTGCAGCTTTAGCAGTAAAC
GAAGCCGACGAAGCTCGACGTTCTGGTCTTTGGACGCTCTTGGATTGAGCAAGACGGCGAAAAGTTTCTGCTTTTGAGGGTACATCTTCAAATTTTGGAG
AAGTCGGCTCGAGATCCCAGGCTAAAGCAATCTCCGGCCGAGTCTGCGAAGGTGTGTCTGGTAGAGCCATGGGGGAAGCTAAACCATAGTCATCATCTGT
AGATGTCTGTGTTGGTGAGGTTGGGAATGCTGGAACGAACGCTGATGGTGACACAATATTCAGAGATATCGGCTTTCTTGTAGCCGATATCTCTTTCCTC
GTGCGTTGTGGAGAATGCTCTGGTCGAATTGGTACTTCGGTTTGCACGGattcctcctcctcgtgttgccactgctggttTTCACCGTGTGGGCTCTGCA
TTGCCTATCGCATCACATGCACACAAAGGTGAGCAGTCGTCgattgtacatgtagaaatacatgtacacttacgaggagctccaacgAAACCGAGTCGAC
GTCcgtctcaagctgctgccccCTTGCTATAGAAGCTGGTAGCGGGTTATTCTTCGAAGCTGAAATTGCAGTCGTAGGGAGGATTAAGTCTAATTCCAAG
TCTAGTAATTGTTCAAGCGCCGTCGGTCTGCACTTGGTTTCCACGGACTTCTCTGCGCCATCGTCCCAGTCTGGAgaatgctgttgctgtagagGAAAGT
GGAGTTTTGGAGATCGGCTGTTGGGTTCCGGCTTGTGTGCGTCTTCCTGGTTACCATCGCACTTTCTCGACGGCAAGTGTCTGGATGCCTTGGTCATAGC
CGTATCGGTCGGGACTGCAACTGTAAAACCTGCACACTGTCGTTTCGTGCCTCTTCGTTTCCTAAATTTCTCAATACAATATTGTAGTAGTTCGCGAATA
TTTGCATTCACATCTTTGGATCATACAGGTAGTAAATCCGATGGGACTGCTGAGTATCctcaagaaggtcaaggaaaaggagaaggaggtccGCGTTCTC
ATGCTGTGCGTcccctctctctctctctctctgtcATTACGTTGACTGGAACTGACGAGTTTACTGACCGATTGTGCCTCAGAGGTCTGGACAATGCCGG
CAAGACAACGATCCTTAAGAAGTTCATGGGCCAGGACATCACCGAGATTTCGCCCACGCTGGGCTTCGATATCCAGACGCTCGAGTATAAGGAGTGAGTA
TGTGCAATTAATTGTTTGTATACTAGATCTCACTGCAGAGAGCTGTTAGCTTCAAGCTGAATGTTTGGGACGTCGGTGGGCAGCAGACAATTCGCTCATA
TTGGAGAAACTACTTCGAGCAGGTTTGCTACTCTGTGCTAGCTAGTATCATTGTATCATTGCGTTTATTTGAGCTGACGTTATACGTACGGGTTGGTAGA
CGGATGGTCTTGTGTGGGTGGTAGACAGCGCCGACCGTCGGAGACTCGAAGATTGCAAGCACGAGCTATCCAATTTGCTCACTCAAGAGGTGAGTACGAA
ATGTAGTGATAGCTGTGTGCGTGTTGTTAACTACTGCTCATTCAGAAACTGGCAGGAGCGACACTGCTGATCTTCGCCAACAAGCAAGATCTACCTGGCG
CTCTCTCCTCTCCAGAGATTGCGGCTGCACTTGGACTGCAGTCGGCCCAGTTTTCCACCCGACACTGGAGTATCATCTCCTGTAGCGCTGTCACAGgcga
tggcctcgtcgaCGGCATCGACTGGCTTGTCGGTGATGTGGCGAGCCGGATCTTTTTAATGGAATAGTGGCGTAAAGGTCGGTGACGAATAGACCGTGTA
CACGCTGTCAATCAACCAACCAAGGACTTTCGCATCTCATAGTTGCAGTACTACCTCTATTTTCGAATATCCTTCGAAAGTGGAGGTATAGTAAAAGTGT
TTTCCATACTTTTTTGCATTAAACAGCAAGATGACAGGATCGTCGGAGGTGTTGGTTGATCGGAATGCCGAGAGGTacaaggcgctggccttCGACATGG
GCGTTCGCCTGTGGCGCGTGGAGGTGGCGCTTGCTGTGCGGAAACTTTTGTCGCTGGGTCGCGCCTACGAAGTGCATTATTCGCTGCCTCGCGCTGCTAT
CGCCGACCTGCAGTTATCGACGCACTTCGGCCTCTCCGTGGCGTCTCTAATGCACACACACGTGTTCCAAGTGCAGAACTGTGAGACGCCCAAGTACCCG
ATGGAGTTCGTAGACAAAGCGGCTCAGAGATCGTCCGCCCCGATCTTTACCGTTAAACCGGACGACTATTTGGTGGGCATGGACCTGGAGGATTTCCTCA
TCTGCCCACGCAAACTGGGCCAGCTCTACAACGATGTGGAGGCTGTAGGGAAAGAGGTCCACgtcaagcaggagcaggacAACGCGTCCAGGAGGACGGT
GGTGCTGCGCTTTGTGCGCATGGGCGAGTGGGTGCAGCCCGGCCCGGGACCCGAACGCTCTCCAGCCCGTATACTCcgtgtgctggacgagatttTGACT
CACCACAACCAGTTACTTGAGCGCTATGAGCTTATGGTGAAGCAGGACCGAGGGACAGTGAAGCGCCTGAAGTCagccgagaagttgctgaagtACGTAC
GGATCATGACTGGAGTCACGAGAAGCGCACTCATGGAAAGCCAGACGTTCCAGTTCATCGATAAGTTCCAGAAATGGTATCTAGCGATAACTaatgatga
tgaagagacAGGAGTTGGTGCAGCCAAAGATATCGTCatggaagacgtggaggagcCGGCAGAGGACATGGAAATGAGCCCAAAACAACCTGAAATCGAG
TACAACATCAACTCTTCTACCCGACGACCCAACACTGCGTCAATACTGCGCAAATCAAGCTCGCAATCCGGACCAACTCCTACTGGAGCGAAGAAACGAG
TGACTTTTGCTGCGGATGTTGGTGCGCCTGAAGAGCCCGACCcagcagacgctgaagcttcagcagccatCCCAACTCCGACTCCTGCTCAGACTgaaca
ggaactgcagaaTGGAGCCACTGCAGGTAACAAACCCAGAACCTTCGGTGTTGATGAGGGCCAGGCATATCTAATGGCCTTGGTCAGCTCAAGCGTCGAC
CTTGTGTCGTCACTCGAAACGCTGTCTACTGCTGTTCAAACAGTTGCATCGTTGGAGATGAGTAGGAATTTTCCAGTGTTTGACGGTCTTTGGGTGCGTT
CCCTACTTTTACTGAGTTGCAAACGGCTATTGAGACTGACAATTTCTTTCAGCTTCGGCGCCACTTACAGATGGTTGGGCCGTCCCAGTATAAAGCATGC
GTCAGACTGGGGCATTTATCATTTGATTGCATGGCTACAATGGATCGCGATGCCGTTATCGGAGCACTGTCGAGGCTGACCAACGCAGTGAAAGACGAGC
AATGGCTGTACGTTGATATGCTGACGCGTTTGAAGGCCCAGTTTGGCTTTTGCATGGCTAACGACACGCGGAAAGTAAAGGACACGACCTTCAACTACCT
CATTTCTAAGCAGATTGTACGGGTACGTTTGCTTTCTATCCATTGTGTTGTATAGCGAGTTCGTGAGGCTAATACGGTGCTGCTGCCCATAGCTTCATGA
GAAGCCTAGTGGAGATCCTGACAACATCGTGTACGACGTAGTTGCGGTCATCCAAAAATGTCCTCTCGTTTACAGGCGGGGATCCTCTTTACCGAGCACG
AAAGGAGAAGTTGTTGACGCTCTAATGCTATTTCTAATGACATtacttgagcagctcgaggagagTCGGGCCTGGGATCGTTTAAGCCAGACCAAGGGAG
AAGTTGAACCCACCGTAGATGAAAACGCCGAACGCAATGAAGAAATCAGGTATGATCACAGTGAGGCGGACGACTATGCCATGGATAATGCCCGCGGAAA
CTCTGGGAGCGTGCATAACGGTGGTGACAGGAATGCAGAGTTGCGATCTATGGGTATATTGCGAAAGCGTCAGTATGCCCCGCATCCAGAAGAAAGCTAT
GAAGATAATCGTGCTGCCCCTCGACCCCGCTTGTCGTACTCAGCCGCAGAGCCACAAGTGTCGGCTCCGCTCGAACGAAGATACACTGAGTATGATGACG
GTGACGAAACCGAGGCAGACACTGCAAATCTGTTCATTGAAGACCGAAGCGGCTCGGATTCTAGTCGTGACGCGCCTGCCCGTTCGGAAGATGCAGTCGC
TAAGGCGAAATCGGATGTGTATCAGGAGCTGTTAATGCTTCTCTTCCGAGATCGAGAGAAAGTTGTGAGGGCTGTTCAAGGGATCAAGTGGGATCTTAGC
GTTACGTCTGAAACAACTCAGCTTTCGTCAACTTTCACGGTAGGTTCTCGCGTTTTCACTTCATCTTGCTCGGTTTAACGAGTACGTGGTGTGAGGTCTT
TAGATCTACAGGACTGCAACACAGCAACGCAATGGCCTTGTGCGATGCGTTTTTAATGCGACTGAAGGCGTGGTCGAAGCATCTGCAGAAGGACCATCCG
TTGATATCGCGAAGGATAAAGCAACCGCGATCCTGGTCGACACGTTGGATGGAATTATCAAGACGTGGACAGATCTACTTGCCACTTATGTCAGCCGACT
AAGTCAAACTCCTACAACTTTGATGGCAGGAAACGAAACTCAGGCGAAAAATCGCGACAAGGTATTGTCTGCCAAATGTTTTACTTCGCGGAAAAATGGA
TTTTGATGGCGATCGGGAACGCGAAGCGGCTAACAATCGGGTTTGTGCTGCAGGTATCGACTGCAGAAAAACTTGTTCCACccctgtacatgtacttcat
tAAAGTCCGTGATACGCTTGCTATTTCGACGGCATGTCTAAACGCTAAAGATGCCAAACGGTCTGCCAATGAACGGTGGCGCGACATTTTGGAGTCGCTG
AACAAGATGAAATCTGGGCCTTCATCCTCGTGCGCTTCAAACGGAAGCacaaacgcagcagcagcgcaatcTACGGCAaacagagctgcagcagcaactc
cagcGAGGACAGGCAACCTCATTTTATGCAGTGACGATGAGATGGATGACGGTGATGATGGCTATGATGACTACTCAGATGGCGGCTTTGATGACGATGA
CTGGGATCCTTCAGGTGTTAAAACGACACAAGACGACCGCGCTGtggcagaggagaaggcagCTTTTGAGCGTGAAATGGCTACTGAATACGAGGAAAGA
TCTGAAAGTGATCAGTCTGACGCCGCCAGATTTCGTGCCACAATTAGAAGCCTGTTTACACCTACTGATGACCTCTGTGCTGGAATTAACAGACTTCGGG
CATCTTTAAAATatcgtggagctgctcacgTACAGATTGTTGCCAACGTTACAGCTACTATAACTATGGATCGTCTTCGAGAGGGCATCATTGAAGTTCA
TGTGAATGTCAATGATGTCATTCGCTACAAAGCTTCAGAGGAGACGAAGTCTGATGCCTGTAATGCTGCGGTCGATGGTATGCTGAACTTGCTGAACAAG
ATCCGATCGAAGTGGGCGCAACTGCTTCATTTTATGGATGCAAAGTCGCTGGAATATTATTCTCCTATTGATTCGTTTCGATATCTCAAGCTTTCAGGCA
TCGCCAGTGTACGTTTTAACACTTTCTTTTTGTCTGATTCTTCATGTTTACCCTAACTTTTTGCTATTTATCTAACCACATCAGATTATAACCTCAGTGG
AAGATCCGCCTCGCACACCTTTTAGTCGAGATCCTCGCTCAACAACTGGCGTCCATTGTGTTGTTAGAGTAGACGAGCATGTGCTGTGTCGTGCTACGTG
GAAGACTGAAGCTGATGCTCGTCAATTGGCGGAGTGGAGAGCAGCCCAATTTTTCATTGATTTGATCGATTGCGGTCTTGACACCAAGCGAActgacgaa
gaggaggacaaAAAAGCAATCGACGACGAATTATCGATGGCCAGGGACCATGTTGCGTGGTCATGCCTTATTCGAATCCAAGACCCATCCGATACTCAGG
CTTTTCACGAATTTCCAGTGGATGCTTTCTGGTGCCGCACCCGGGATGGGATGGCGCCAGTGGAGTTTCCAGATACCAGAGGCATTGTGGTGACACAGCG
TGGATGTGTTGGGATGGGTAAACTGGAAACCGAAGTTCGCAATTTCCACCAATCGACCATGGCATTTTTCCGCTTGGAGTCTGCATATGATCACTGGAAG
TTTGTACGACAACTTGTCCGTTATTCGGATAAGCGGAAGCATAACACGCGGGCGCTTGCGTTGACCATCTCACCAAATTGCCCGTACAATATGTATGTGA
TTCCGCCTGGAGCATCCATCAACAGTGAACACAACACCTACTGGCCGGAAAAGGCCTTGCCTCGTGTTGGTATTGATCGCAAGAGTGTGGTTGGCTTtct
gacgacgaagaacatCGGTTAATTAAGAGAAACGGAGGGAATaagtggtggagaagtttGAAAGGGTTTGGAATTTCAAGTATATTTGAAGTAAGTGGTA
GCTGCGGTGTGGCTCTCGAAGTCaatcgtcatcgtcgtcatcctcttTCCCATTGTCGTCATCCATTCCGTGGTGTTTGCGAAAGACTGCGCTTTGTGTT
TCGCTGTGGATCATCTCGAGGTACTCAGCATTATGAATTTCAAATCTTCGCTGCCGAATGAGGTGTCCAAAGTCGCCTATTGTTCCTCCGTCGTTAAGGT
CGTGGTCAAGAATTAAGTCCATGAGCACGTCACACATCCGGCGCACCTCAATATTCGGTGCGTCAGCAGCGAGAAGTAAGTCCGGTACAAAGCCGACGCC
AAAGAGAATCTCCTCGAACGTCTCTGGGTGGCGCAGCATGCGATAAAAAGCATACAACAGCTGCAGGGTGAGCTCGTTGTcatgctgcttctcctggaag
agcgagtgGAACGTGCGCACAAGCCGAGAGGATGACAGAAGAGGAGCGCACTTTGCCTCGAGTGAAAGTGTACTGACGAAATTCACGACTTCAAGGATCA
TATCGTCTTGGGAAAACCCTGGCACTAGGAGCTTGTTGAGGAAAGGGATCAACGAGTGATCGGTCACCAGTTTATCCCACGAAGTCTTGGACGGTAGATC
GCTTGGGGTCATGTTCGCCAGTGTCGCTAGAACTTCAATCGAGAAGTCGTGGTTGTCCGTGTTGAGGCATAGTTCGATGAGTGGCACCACGAACGGGGCC
CACATGCCGCGATACTTGTACGCCTTGTCACTGACCAGGTCTTCTTGAAGCGTGTATGACCAGAGTGAGATGTTTCGAATAACTTTCATGAGCAGTGGGT
CGCGGGTGCGGAACACTCGAGCGGCAAGCGCTTCTAAGCCGCGATTTTGACACATCAGCTCGGCGTTACGTGCGTTGTGGCTGAGATTCACAGCCAAAGC
AGCTAGCTCCTTGGCCACAATATTCTGTGGGAAATTGATCACCAGTTGCATGACGATCGGAATGGCCTCCGTGTAGGTAAACATCGATTTGCACCGGTCA
TCGATGCTGAGGTGGTAGAGAATTCGTAGGGAGAGCGCTCGAAAGGGTGGTTTcttgagcagatccacaAGCTTGGGGATCAGGCTGTTTCTCACCAGAA
CTTCGCGAAGTGTCGGGTCGAACGACAGGTTAAAGAGTAGTTTGAGGGCTGTTTGAATTGTTTTGTCGTGGCTGCAATTGAGATAGCGCACCAGCTTCTC
TACCACCGTAAGTTCCACCATGACATCCTTGTTCTCTTCAAAAATGCTCAACTTTTTGAGAAAGATTATGGTTAGAATAACCAGATCAGGCGCTACGCGA
TCCAGCAGCTATCCGACGCGAGTTCAGAAAAGGAGTTAGCAGCTTGCATCTATTCAGCAATAGGAGAGACAACGCACCTTTGTCAGGAACAACACGATCT
TGCGTTTGACCATCTTTCGTTCAGTGTGGATGTCTTCCGCCAGGTTCAGCAGCACACTGAAGCACACGTACCTGTAAgaataaaaataaaaatatgCACA
GGTCAGTTCAGTTTTGTCTGCAGAAGCTTGTGCATACTGGTTTCCCCACAGAAGTTGGtcttgcttcttcatgcgcttcttgttgcgcttcttctctcgg
TCCAGCTTGGCTAAAATCTCGTCCGTATCCCCCGTTGAGGCATCTTTGGCCGCACCTTCtagcagcttctcctcctcgagACGTAGCTGGtggcgcttga
gctcgaactcgatgATCTTGAGCGTGACAGCTCCAATGCGGTAATTGGCCAGTAgtggatgcagctgcaggaagttGGAGAAACACCAGAAGATGCGCAT
CATGGTGAGCGAGAAGTCGTAGCTCTTCTTGTAGTCGTCGTTCAGCACTCGCGACAGGAGGCTCTGCAGGCCAAGACGAGCACAGTTCAACATACAATCA
AGCCACAGTCCACAGTATAGTTTGCACAGACCATAAGTGACTCGTTTTGCACCAGAGCCTCGATGTTGCCGGCGAACTCCGCCAGTTGCAAGATCATCTT
GGCCCCTTCCAGCTTggactcgacgtcgtcgtcgtagagcttctccatgtaCGTGTCCAGGTCGTCGGCCTTGGCCGTGATCTTGCGAagcttctcgctc
ttgagcaCAGTTGCATGGCTTGGGCCTCGGCTGGAACTCGTTCGGGAGCTCATGGTGGCCGTTTGGGGActgctgagctgctgagcCTGGAGGGGTTTCA
CCGTGACGTTGAAGCTTATTGGCCAATCAGAGACAAGCGTGGAGTTTTGGCGCCACAAAAAGGCAACTCACTCTTGAAAGTGGCGGGCCCACAAATCACT
TTTGTGTATTATATAGCAATGGACATCCATCCGAACACCTAGGCACTCTGCAATTTACTTTGAACTACCGGTACCGTAgtgaaggaggaagatggctaca
tctcGACTGGTGCAGCGCACTGCAGCGTttgtggagcagcagctcaagagcaaCGACGCGTCCCATGACTGGCGCCACATCGAGCGTGTCTGGACGGTGG
CGAGGACGCTGGCAAAAGAGGAGGTGCGTGCTATGGCTGGTGCTATTGGATGGGGCCTCCATTGTTGCTTATTGAGCgttctgcagcgcgtgcCTGAGGA
AAAcctggagatcgtggacCTGGCGGCTTTGCTGCACGACATCGATGATTGGAAGTACCAGAGCGATAAGGAGAAGCCTACCAAGCGGGCGGTGGCCTTC
TTGCAGGCGGAGAGTGTGTCCGGTGATAAGATCGATCGTGTAATGGCCATTATCGACAGTATGGGCttcaaggaggagctggaaggcaaGGGATCGGTAC
GTTACACTGTTTCTAATCGGATCCGTTCTGGTGGTCCATATTAAATGGGACTAACGTTGCTGTTTTTGGTTGTTAGCAAGCGTTTTCCGTTGAGTATGGC
TGTGTTCAGGATGCTGACCGACTGGTGCGTTGCGGATCAATAGCGATGGGAGTAAGACTGAAGGACTAAGGACAATGTTTTGTGTAGGATGCCATTGGGG
CCATCGGAATCGCACGTTGCTTCACGTACGGAGGACACAAACTGCGACCGCTGTACGACCCGGACGTGCCCCCCATTGATGGCATGACCAAAGAGCAGTA
CATGAATCCGGGCCGTCCCAATACGACCATCAACCACTTCTATGAGGTATGCACGCACGCGCGTGTTGacagttgttgctgctggttttAAGTCTAACCA
TTCCGATGTTCCTGTGTTGTCTCTTGATATGCAGAAATTGCTGAAACTCCGTGGTATGATGAAGACAAACGCTGGAAAACGTCTGGCCGAAGAACGCCAC
GCGTTCATGGAGACGTTCTTGGATCAGTTCCACAAGGAGATCAGCGGTCGAGGCTAGATCTGTCCTGCAAGAACGATCTACTACTGTACTGTGGAAAACA
GTAGAACGAGCTGGCAAGGTAGACGAACATACCTTTTTTTAATTCGCGTGCAATCTTACTGCAATCATGCGCGACTACTTTGATTGAAGAATCTCCATGT
GCTCGTTCCTCTTTTTTCCTCTCTCCGAGCACTACACAAACAAGGGCCACTTCGTTCTCTTTATCCAGGGGGCCACCCGAGCTTGCGTCCTCCGAGTagg
tgcagatgcagatggaATACTGACTGGCAGCCATCCTCTCCGTCGTTGATGACAATGCGGAAGCCCTTGTCcaagttctgctgcttggcgacCAGCTTGG
CGGTATACAGCAAATGACCCAGCACAGCCTCGTGGTGCTCCTCAGCGTGAGCGAGCTGCGTGAGGCCATCGCGTTTCTTGGGGATGAGAAGAATGTGCAC
GGGAGCTTGCGGGTTCACGTCATGGAAGGCTAGACactgctcgtcctcgtacgCGATCTTGGCGGGGATTTGTCCATTGatgatcttgtcgaagatggTC
TCGCCCACAGCAGTGGAGGCACCCGAGGCGGCGGCAGCGTCGGCCTTGGAGCGCTCGTCAGAGCTCATGGCACGGAGGGCGAAGGGGGGCAACGGGCGAC
GCGAAAGCGAGGGTCCGGACGccaggaagctgcggcgaagagctccgatGAGCATGCTAATCAAAGATCAAAGATCAAAATGGTGTGGCGCACCCACCGT
ATCCATCAAAATGGTACAAGATCAGGCGAGTGAGGCAAGGCAAGTTCTCGTGGCATGGCGGAGTTTGACAGAACTCGTTGGGTTTTGGAGTACACAATGT
GCTCAGTACATGCACGTGTCTGTAGTAATGTAATACTAGTTAGTATGCAGCATACTTCAGCCTCGACGTTCCACGTTGGTCTTTTTCCGGTGCGCCATCC
TACCTCTTGAAACACATAAATGATGATATACGATGCATATGTAATCTGCACGGCTCGTTCTGATTCTTACAATGATCCATTTAAATAGCATAGAACCGCC
AACTTCAATCCTCCACACTACCATCCCTGCCAAAACCGGTCGCTAGAGCTCATCGTTTGCGCACCACACGTTAACGCACTTGCATTTCCGCCCAGATCGC
AACAAGAGCTCAGCAGTGAGCACCAAAGggctaccggtagtacaGTAGCTAGCATGACCACCGTCGcgtcggagcagcagcaggagcaggttGAAGCCGT
GCAGGAGGGCACCTTCAGCCTGCTGGTGGCTCCCCCCACCTCCAAGAGCGCCCAGCCCGTGCGTCTAGAGAACGTCAGTGCGTCGGACACTgtcgtggcg
ctgcgccagcTCATCGCCGAGTTCCCAGCGCTCGCCTGCTACACGAGCTACCACTTGGAGGCCAAGAGCCTCTCAGGCGACACCTGGCAGCCGCTTAACG
ACTTCGTGGAGCTCGCCGAGTATGAAAATGTGACGGAAGGCGCCACTCTGCGCATGGTGCTGGATAAGTACGACGCCCGCAAGGTGCGCGCGCAAGTCCG
TCGCTTCCGTGACGTGCTGAGCAACCCGCCCATCCCCCAGGCTGCAGTGGAGCCTGAGGCTCACCCGGAGACTGCTGACAAGGTTGAGGAACCTGCTGAT
GGCGAAgagatggacgagaagaagctgaaggagatttcggagcagcagcttaaGCGTCTGCGTGAGATCCACCACAAGCTCGAGGGTATTGAAGTCCCCG
TGGCTCCTGAGCTTGCCGAGTTCTACTCGTTCCctggcgctgcttccactacgcaggaggagaaggagcaggcaGAGGCCCCtgccaagggcaagaagag
caagaagggcaaaaagaaccagcagaagcaaaagcagcaggagaacgaagccaaccagcagaaggagcaggaagcgcagcacgCCAAGCTTCCTGCCTGC
GTTAAGAGCATTGTGTTTTCGGGCTACAACCCGCCTCCTGGACCGCGTAAGCTGGCGGGAGACCTCTTCTACCTGGAAGTGATCGTCGCTGGTGACAACA
CGCGCTACCACATCACAGCGCACGTCAACGGTTTCTTCGTGAACCGATCGACGGCCACCAAGTTCGACCCGCGCCCGCACAAGACCGCTGCAGCCCACTC
GCACTTGCTTGTGGACGTGTTATCCACCGTGTCGCCCAAGTTCAGGGAGTCCTATGCTGGTCTCCTGTCCAAGGCAGCCTCTCTGGCTAAGGAAGGTCCT
TCGTCGATCGAGTGGATGGTGGCTGCTGGGTCCAACCTTGGCGGAAAGCTGCCCTGGAACACccctgttgctgctgcggaggaggagcaccACTACGACC
TCAACCGCGCGGAGGACGAGCTTTGCGCCTCCTACGGCATGGATGAACGTGGCGTGCTGCGCGACTGGAACGAAGAGTACCAGTGCTGTCGCGAGCTGCC
TAAGGACTCACTccaggaggagatcgtgcgcGCTCGTGTCATGTACAAGATTGTGACGGAGTTTGTGGAGGCTGCCACACAAGGCGCAGTGGCCATTGTT
GAGGGAAACATTCCTCCTATTAACCCCATGGATGACAAGAGTGCTCACGTCTACGTTTTCAACAACATCTTTTTCTCAGTGTCCATTGATGGAAACTCCA
CCAaggatgctgctggaggtgagGAGAACGCCTTCTCGGCGGCCAACCGCGACCTGCAGGGCGTGAAGGCATTTAACGAGGTGGATGTCAAGGGTTTGCA
CACTCTGGCCACGACAGTCGTGGACTACCTTGGAGTCCGTGTCATTGCTCAGAGCCTTATCCCGGGTATCCTTATGGGCGATGCTGCCTCCAAGCTCGTG
TACGGATCGGTAGACCACGGTAAGACTATCGCTGCCAACAGCGACATGCACAAGCTCATGCTCGAGGCAGGCGCAAAGCTCCACATCGCTGAGCGTAATA
TCAAGCCTCTTGGCAAAACTGAAGCTGACCTAGCTGCGGAGAAGGAAATGGAGGCTCTTGGTGGCCCTGTGAGCAGTGGAGAGGCAAGCACGGAAGTGGC
AACCATCTGCGGTGCCGTTGAGGCAAAGGGAATTCAGGGCTCGGACGGTCGCCTGTATGTCTTGGACCTTGTCCGCATTACTCCGAAGGATTGGAACTTC
TACAAGAACCGCGAAGGTGCTCTAAAGAAcaccgaggagaagaaggataCTTCGCCTGAGGAGGACGGATTGTGCTTCACGCGTAATGACGAGGGCTATG
TGGCTCTGTTGCGtccggagctggtgcagctttACTCACTGTGGAAGCAGAACCAAGCTAGACGCGCTAACCGCGAGGCTCGCAAGGCAGCCAAGGAAGC
TAAGAAGACCGCGGAAGACAAGGAGAAACAGGAGAACGGTGCCAAGGAggacgccgagaagaagggCGATGTTGCTAGCGAGCAGGAGACTGGAGAacag
gaagacgaagaggaggaagaagaaattccACCGA