Description :
From Genome Similarity Track
Location :
Scaffold_988:8586- 10445
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_988-snap-gene-0.4Heat shock protein 70kD

Sequence
1859 bases(100 bases per row)
CGAAGAAGCACTGCGTATGCCCGATGTGTCCTACAATCCGACTTTAAATCCGCTGGAGGTCCGGGTGAAGTGTTCGAGAGCAGCAGCGTCACAGAACGAG
TCGTGGCAAGTCGTGATTGCGTCGAGCCTTCGGCCTGGGATGACATCAAGTGAAAGGGTTGCGAGCTACTTTATTCAACAAGAGCAACTTGGTGGTGACA
AAAGCACACCACTGGGAGCTGACATGTACTCTGATTCAGAGCGATGTCAGTCCTTGAACACGAGCAACGACGACAGAGAGCCCGAGTCATACAGCTGGAT
CAATCGTCCGAGCGAGTCGTCCAGCTTGTGCTTAGACGACCTTACCGACATCGACATCCTCTCGCAGATCAGCGCGTACTACGGGTAGCCAGCGAGTAGG
AAATGAAGTGAGATGGGGGTATCGAACCGTCAGTCAATACAGGAGAAGATGGGCGACACAGTCGTGGAAAGAATCACGCTCAGTCAGTTTACAAGTAGTA
GCTTTTCCAAGCTCTCCACGCGAAACAAAACAACGCAAGAACAGTTTGTTTCATCTATCAATCAATTCATACAGGCCCATTCGGAGACGGCAGTTCCTGT
GGTTTGAGGCAGAAGCAGATCGACTCTCCGACGCACTCTTTTTCGCTAAATGCATTCGTCGCTACGAAAGTGTTGTGTGTGTGTATGTTTTACAGAGAGT
TCTTGCGCTGGAACGTCGTGGTCGGGTTGCTCTCCGTGTCCTCCTCTGTGGTCGTGACCTGGACCGACTCGAGCGGTGCCGTCTGCTGGAACTCGCCACC
GACATCCTCCGACACGTCAACGCCGTAGAACTCATGGATCGTCTTGACCGAAATCGTTACGTCCTTGTGGTTGATGTCCTTGAAGTACGCTTCGTGGGTG
ATCCAGAGCAGCGGCACGACGTACAGCGCCGTGAACACGTCGAGACTGTAGTGCTTGCGCGCCGCGACGATCAGGAATGCGATCGAGATCTGCACGCACA
CCAGGAACGTGAGCAAGAATCTGTTTGGCCAGTACTTGATCATCGTCAAGATGAGCGACAGTGTGTAGATCGTGTGCGAGCTGAACATGAGATCACCACA
GCCGTTGAGCGCGTCCATCTTGGTGAAGAACTCGTGACCATGAGGAGGGATGAAGTCCGGGTTCTCTGACATGCATTTGAGAATCTCGTCAGGTGGGTTC
GCCGCCGCGCACGCCTCGTCCACAATCAGGCGGCAGTGACGCGCTGGACCCGGGAGCGACGTCAGCATGAACGAGCAGATGCGAAAGATCAGCGCCACAC
TGATGTGGAACAGCACGCGCTTGAGAATGATCACCATGTAGCGCGGGCGCTGCGGGTTCTGGCGGAAGAGCGGCACCGTCAGCACCAGAAGGATCGCAGG
CGCAAACACGCCGCCAAATACCAAGTACTCGGACCAGTGCGAGTTACTCTCACTGTCATAAAGAGAGAAAGAACGCGTGAGTCTCAACGCGAATGGACAC
AATCTAATGGTGATTAAAGAGTGAGGGCGTACCTGAGCTCCGGCATGAGTTCAAAGCCGAGATCGTACAGCGGGAAGCGCTGGATCACCGAGAGCTGCGA
ACCCTGCACCCAGTACGCCAGGTTGTGGAAAATGCCATGGATGTCTGTAGTTGTAGTAGTAAACAAAGGCAGTAGAAGAGAAAAGCGTTAATACCATGAA
CCCCTTCATCGTAGCTTCCTTTTGCTTGCAAAGTAGAGCTCTCAAAACGATAGAGACAAACAAACAAACAAACGTACACTGCATGATCACGCACGGCAGC
AGGATCTTCCACTCCTTCTTGAGTAGCTGCAGCTCGATCGCCGCGTACTTGAGAAAGTT