Description :
From Genome Similarity Track
Location :
Scaffold_32:85854- 89313
Sequence
3459 bases(100 bases per row)
AGAGAGGATTTGTCTTGAGCGATTCCCACGATTGGGATGTATATCGCTCAATCCAAGTCTTCTCATCAAGAACACTCTCTTCCATTGATAAGCTGCTGAG
AACCCTTTCGTTATCAGCGAATACCATTGCCGACCGAATATCGGTTACGTACTCGTCTTCCGAGACGAGTACGCAAATCTGCTTGACTTTGCCACTACGC
AGATCACGAAATAATCTCTTCTGTTCGAGCGTGGGTAATTGAGTGATCTCCGAGGTTGTCTTCGGAGGCGCGATCAGATCAAGTTGGTAAGTGCCTATAC
TTGATCCGTCATTGACTAGGACATTTAATGTCTCTGTTGTCTCCTGGGAACTTATTTCCACAGTTGGGTGGGGACTTATTCCCTCACTAGCCTCTTGGGC
TATATCATCATATGACACGAGTGGAATTGCTCCCTGGTTATCTTCTGGCGGTGGTTGTACTACCGCGACCAGGTCTTCTACGTGCGATTCTCCAATCGCA
CTAAGATCATCGTATTGTCAATCATTGGCAATCGGTTCGTTGTCACTTGGGTGTTGTCCTTTTGGAGGACACCTACGCCCCAGTCCACTCGACTTATTGG
GTGGTGGGCCTTCGGCGCGACCTGCATCTCGATGCAGTCGCCGGTATCTGGCTTCATGGTGTGGCAATCAGCCACTCCATGGCCATGTGCAGTCGTGCTA
ACGACCGGACCACACGCGAGGCCATCGCACTCGCTCGTAGTACACCCACATGTTAGTGGGCGCTCCATGGCGTTCATCAGATGGCCATCTGATGAACAAG
TGACAGGCATATCGACTGTTCGTCGATGCCAGCTGACTTGTGGATCGTACCTTCTGAGCCACGGCAGTCTAGGATGACATCAAATTTGTCATCCAAGTCT
AATATGATGAAGTCATCATTATATTGGACTCCCTTCAGTGTATAGGTAATACCCACTACACGTTTCATCACTGTTACGGATGCGCCTGTCGCGAGCCGCA
CCGTCATCCTTGTTGGAGGGATCTCTCGTTCAACATATTCGAGCTCTCTTTTGTCTAGCTATTGGTGTTGTACAAAGTTGTTCGACGCCCCACAATTGAC
CAGAGCTCGAAGCGACATGCTTTTGTGTCACTTCGAGTTCCAAGGTAATGAGGTTTCCCTCATTACCAGAAGCAGCAACACACAATGACTGAGTGTTGGG
AGCAACTTTCTTCAAGAGGCCTGCAAACTCACTTGACGTTGCTGGATCAGTAGGGTGCTTCGCACCTACTGACCCTGACCGTTTTTTGGCTGTCCGTGTC
CGTTGTTGCGTTTTCGAAACGACGTCGGACCCACGCCTTGGACCTCTCTTGGCCGCTTGGCGGTTACTGTTTCCTGCGGTACGTGGTACCGCGCTCGGGG
AACTGCATTCATATGCATAATGCCCTGTCTTCTGACATGTATTTCATTTTTGCAATTTCTTTTAGTTGTTAATACGAGAGCTCTCGCTCCTCGCGTTCCA
GAGGTCCATTGGTTCTGGGCCTCCATTTTCCTGTCGTCTCGATGGACGATAGGAATTCGAATTCGCGTGAGCCTGTTTCACGCTGAAGTCCTATTGTTCT
GCAACCCTTATTGCCTCTTCCAGGGTGTTGAACTCCAATCGGAACAGGTAGGTTTTAACAGGACCATCAGTCATACCCTGCATGAACAACGTAATCAACG
TTTGTTGGTTCAGTGGGTCGACTGTTATGCAACTGGTAAGGTGACGTATGTACTGAATGCACGAGTGTACGTCACGTTTACCTTGCTTGATTTTAAGGAG
TTCAGAGCGAGCCCTGAACTCAGCTCGCGGCGGCTCAAAAGTTTGCCTCAGCAGGGACTTGATGACTTCCAAAGACCCAAAGACATATGTGTCGTGTAAC
TTAAGGCCCAAGGACCACGTCTTTGCACGCTCTGCCAAGTTCGATTGAGAAAATGCGATCTGCATTTCCTCATCGACGATATGACGAGCCTTTATGTCAT
CGTCTAGTTCCACGAACCATCTCAACAGAGAGTCTTCATCGGATCCCTTGTACTTTGAGATGTCAATCTTTACAGTCTCGGGTCGTCGTGTATACGTCGA
CCCGGTAGCAGTGTCCTGCTGCTGTCTCAACAGTTCAAACTGTTGAGCACTATGTTCTCTCAACAGCTCCGTCTGTTGAGAACTTTGTTGGTGAAGCAAA
GTTACTTTTTCCTGCTCGACGTCAAGTTCATTCTGAATGAACTTGGCGATGGTGGCGTGCTGTCCGTCTGACCTCAGGGCGGACAGCAGTGCGCCAACGG
CTTCTTGCCCTATCGTTGAACTCAAGCGTTCGACAGCGTCCTATTCGATTTGACTCAAATGGGAGTAGCTTTCATGCGTGGGATGAAAATCATCTCCCTC
ATCGTCCAACATATTCATGGTCGTTGAACGGACTACGAAGTACTACCAGGTGTAACGGGGCACACCTTATTCAAGTAACTGAATAAACCTTGCACTTCTG
ATAGTGCAAGGGTGTGTGCTTCCGACTACCTCACGTACACGTACGTGCAGAGGAAGATTGCGATACGGAGTAAGAGTACTTAGTAAAGGTAAAAAGTAGA
TGTATTTAGTATAGTTAATTCTTTTAGTAAATCCCTATTTGACTTCATTTAACTATGTCTAAATACAAACATGTATTATAACTATCTGCGCGCCACTCAT
TGCGTGCTTCTGTCGTGGCTAGACTTTATTGGTTGATATCTCGATCCCATATCAACCAATGAGCAGTGTGTTACATCTGCGGGGCAATATTATCTATTAG
ATAATATTGTGAGAATATTGTGTTTGTCCTAAAGCAATATTCATACTTGATATTTACCATATGTAAATTATCATGTAACGGAGGCACCCCGTTACAATTC
TCACCTATTGGGTGATACGGACCATCATATCAGTCAAATTTAGCCGTCCAATCGGGGGTGGGCGCGCGCAATGCGTGGTGAGCAGGACTTTAATATACAT
TTTTGTAAATAGATATAATTGAGTTAGGACTAAACACAGGGAAATGATTAGAGCTTTATTATATTTAATACAGTTTTACATTCTACCTCTAACAGACAAG
TTTTTAACAGTTAGTCTTCCTCTGTACGTACCGTGTACGTGAAGTGACGCGTGGCCATGCAGAAATTGTGTCAGTGTAAGCGGCATCGTACTGTGCGAGT
ACAAGTTACCAGTGCCCCTTACAATACCGTTAAGAATTCTCCTTTACGTGCAAACTAATGTCGCGCGCACCTCCATAAAAATTCTATTTCTATCATTATT
ATATCGTTTACCCTGTGCCGAGATGGATAGTGGCCGTGGCGGTTGATCGGGCGATCGGTACAAGTTTAATTGCATAGTTTCTCGACGTGGTTGACTTCTT
TTACGGTAGACAGCGACTAAGTTATAAATATGTTCTACTGGCCGCAGATACATTATCCA