Description :
From Genome Similarity Track
Location :
Scaffold_23:85820- 86910
Transcript NameFunction/comments
Phymu_g1518hypothetical protein

Sequence
1090 bases(100 bases per row)
CGAGCTGTGCGGAGGTTGCGGTCTTGTCCTAGAGGGAGAAGCCGTTGGAGCTCTGAACCAGTACTTTCACTATGAGGTGCGTGTGTTTATGCTGATGTGG
AATGCGCAGTAAGGTGCTAATCTGTGTTTATTTTGCGTAATAGTGCTTCAAATGCAGTCACTGCAGCCGAGTTAttgctgaagatgatggaTACGCAGAG
AAGGACAACCAGGTAATCGCTGCTTGCTAGCTCTGGGCTTACATCTCGATTTTTTCTGACGCGTTGTGCTGATTTAGGCGTTCCACCAAGCTTGCTACCA
GTCTCGTTTCGGTAAGAAATGCCACCGATGTGACAAGGTGCTTAAAGGAAAAGTGGTCAAGGCACTCGACCATCTTTACCACCCAGACTGCTTTGTGTGC
TACCAGTGCAGTTCTTCCCTTTCAGGTACACTTTGAAACGAATATTCACGCCCTACTTCCTGGTCGAGGTATGTGAGCTGTCCGATACTAATACAGTTTG
ATGGTGTTTTATCGTCCAGCAGAGAGTTTCTTCGAACACGAAGGTCAGGCTGTTTGCGCAAAATGCAAACACGCGGCGATTGCGGTGGATGAACCCAGTC
TCCCGTACGTAGCTCTTTAGCTTGAGTGGCCCTGCATCTTATCTGGCTAACGTCGTACTGCTGTGGATCGGGGGAAATAACAGAGAGAACATGGCTCCAG
TTGCCAAGGGTATTGCTGGCTATCGGTTCGACGCCCAGGATGACACACAATTGACTATTTATCCTGGCGACGAGGTCGCAATCCTCCAGAAGGTTCGCTC
ACTACGATGGTTGCTGTAGCATGAGAAGTGTTCTAACCATTGGCTTATTCTACGCGACAGGATGATGATGGCTGGTGGCTGGTCGAATTAAGAAACAAAC
GGGGTTACGTTCCAGGCTCGTACTTGATTGAGCGTCCCATTGAAGAGCCGAAGCttcagccgaagaagaaaaagagcGCTTTCAAGAGcaagccgaagaa
gacgccggGACTCTGTAGCTCGTGCTCAACGCAGAacccagcagaagctcgcTTCTGCCGAAGCTGCGGCAACAACCTGAAGGCTTAAAA