Description :
From Genome Similarity Track
Location :
Scaffold_500:8581- 11743
Transcript NameFunction/comments
Phypl_g8921hypothetical protein

Sequence
3162 bases(100 bases per row)
ctcgctgctcgtaTGCTAGAATATCCTCCAGCGAAGGCATCCCAGCAAACTGGATGCACAGCAAAGACCACAAGAACTTCCGCCACGACACCGCTCCTCG
AGTTGCGCATTGCTGCAGTGTGACTGCTGCAACCGCGCTTGCAtctctccagcgccgcggaAATCCCTCCTTTGCTGCAACCTCGAGGACCAACGCAACG
AACACGTCACTCGCGATGGCCGCGCCTCCAAACGCTCCAGCTGCGATCGGATCAGAGAGTTCCCAAATTTTGCAGACGTGCGCTAGGGCACAAAGTTGCG
GTATGGTGAGGAAATTCTCCTTTTCAACTCGTGGTAAATGAGTTGCAATGCCAGACATTGAGCTCAGCTCCAGGTCTCGAATGGGCCAGGTGGCACGCCC
GTGCGTCTTGACGTCCGCCATCGCATCGGCGATTGCCTTGTCCTTCCGGTGGATGTCGTGTTGAACGgcttgctgcagacgccgcagaTCGCTCGCATAG
AGCTGTCCAGCCGTTTGCCGCAATCGATCAGTGAAGCGACACAGCAGCGCAACTTGCTGGAGTAGCCGTGTGATCTCCTCTGTGGTCACATTCGTCTCCC
TTAGAGCGTACTTCTGAGCTGGGGGCTCATCAGCCAAGTGGAAGGAATATTCGGATGCCACCTGACTGAGGATATTCAGCACCTCTTCCCCAGCAAGTTG
TGCGAgctctccacctcctgctttGTCACCCCCCAGCTCCGTGGCAGCCCCCATAGCCTCCCGTGTAAGTAGTTTGGAAAGAACCACTTTACATCCCGAA
TCTTGGAGACTTTCACAGAGGAATGGTACACGATCGTACAGCTGAGAGCggagcacctccagcttttGTATAGCGTAGTCCTTGAGGTAAAAGCAGATCG
ACGGTAGGCATTGGTACACGATGTCCACGGCACCAATAACTTCTGGGAATGGGTCTTGCTCAATAGCATCAACGAAATCGTTGCCTGCTACGCGGTTGAA
GTCTGCCAGGTCCCCAAGCGAGACTTCCAGTTCCGTCAAAATGCGCTAAATCCAAAGCAAAGTGAGTAAGCATGGCAGAAGTTCGCAGGTACACCTAGTA
AAGTAAAGATGAGCCAAACCTCTCGAAGCTCTGGGTTCGACGAAGCGTTGGCAGCCTTCAACTTTGTCGCCGCCTGGTCCAGAAGGGCTTGAAATGGGTC
GCTACCACTGAAAagctcgctctccagctcctgctcggcaGTGACGGACAGTGCGGAGATGGCTTGCATAACTGATCGAATTGTTGCCATCGGCTCACGA
ATTTTCTGGTGGAGATTTGTCTCTAACTGCGAATGAAGCAACATGTTAGGCAGTACAAGACACTAAGACACTCGTACTGTACCAAGGAACCTCCATAGGC
TTACAAGAACAACAAAACtcaccttctgcagcatTTCGAAAAGTTTTGCAaaggcctcgtcctccagctcgatcTCTTTTGCGGCTTTCATCCACCCGAC
CCTGTCAATGAGGTTCATTGACGTGTGCTTCCTGTGCCGTTCCTCTTTCAGCTGCTCGGGGAAAGCGTCGACCCCACACTCGATCAGCGCTGGGATCGTT
TTGTACGATGCCTGTGTATAAAGGTCGATGCTCAAATGAAAGGCCTCCGCCACCACATCGCGGTGCAGCCCCACTCGCTTAAGCTGAACGTGGCGAGTCG
TTTGACTCCAGTAAGTCTCCAGATTCGATCTCTGCTCTTCGTTACGAAtacgctgctcttcgtccagtGCAAGTTTTCGCTGGCTTTCGGCTGCTAACAT
CTTTGAAGGCGAGGGGCTCGGCTTATCGACCAAGTCTGAGGAGGAATCTGAACCTTGCATGGTTTTCTCTGCATCTGCTTGCTCCACCACTGGAGGCAGG
TCGGGAGATATTGACACCACGCAATCCCAAGCAGAAACAATGGCAGGAACAACTGCCTCCTCTGGAAGAGCGGTGCTTCCTTCATAGTTTGCTGCATTAG
TTGGGTCGCCTTCTTCCCTCGGAAGATCTGACAGGATTGCCTTCTCTAAACGCTTGGCTTCGTCCAGTGTCCTGTACGCATGTCGACAGATAGTCAATGA
CAAGAGCGTTTCAATTGACGATACAGAGTTAACGCGTGTAAGGATGCCTTACCTTGGGAAATTGTGTAGCATGCATCCGTTTGGTGATATGTTTGCAGCA
ACTTCGAGTGGAGTTGCTAAAGTGTCTCGTCGGCACAGGGATACACCTTTTGCCATGATCTCTACAGCCAAAGTGTCCGGAAGTGGCGTACTCTTCTGTC
GAAATCCGGTGATCTTTGGTCCGAAGGGGCCAAGTTCCCGCTACCATAGCCAAAGTGCTTTGTTAGCAGCCAGAACAACTACAAAATGAAAATTGTGCAC
ATGTTTTCCACATACCTCGCGGTCACTGAGTGACGCAACTTGGTCTCCGATCTTTTGAGGGTCGTAACTCATCTTCACGCACTCGTCCACAAGGGGTTCC
AGTTGCAGAAATGCCAGGTGGTGCTCCGTCGAGACTCGTCGCGCAAGTTCGATGCCACTTTCGTCCTCAGTGAACACGCTCAGCAAAACGAAGGAAGCAG
GGCGAGACCAAGACGTGTCCAATGATTTGCTTGGGCTGCCCCAGCTTTCAGCCAAGGCTTGAATGTCGCTCTTGACGTCGTACGTGGTGATCCTGGACTG
GAGCGGAAGCGTGGCCCACACTTCCGAACAGGACAAAAAGTTTTGGATTGACGCATCCAGCTCGTACTGCAGTTCCTGGCCGCCCTGATCACAGAGAATT
GGCAGTGGTGGGGCCACTTGAAGACACAGTTCCTTTGTCAGAGGTTCTACGTCCAGTGTGTCTCTTTCACTGCAACACCACACAACCATAGCCACTCATG
AGTTAAAATCACTGGGAAGCCAAGTACCGAGTACCCTTCAAGTCGTATTTACCTGGAGGAGACAACGGCCATCGCTAGAGAGAACAAACCATCAACAGCA
TCTGAACATACACCCCaagcgcgaagctgctccttTTTACGCTTCGCCGAGCGAAGTTCTTCCAGTACCTTCATGTCTTCTCCCCGTTTTACACTTCCAA
ACTCCCGTAAGCGAGCGTAATTCTCCTCCAGTTCTGCTCGCTTATCTTCCAGGTATTTTTCA