Description :
From Genome Similarity Track
Location :
Scaffold_552:8580- 16634
Transcript NameFunction/comments
Phyag_g6571hypothetical protein PHYSODRAFT_470076
Phyag_g6572hypothetical protein

Sequence
8054 bases(100 bases per row)
TGCAGTCGTTGATATGCGCTGCTACCGTATGCCCCTCCCAGGGCTTTAATACTACGGCTGCAATCACCCTCGTGCCCATACCCCAGAGTACAAAAGCGAT
CTTTCTCGCAACATTTCTTTCCACTGGTGCTGGTTGTTAGCGCATACTGGTGCCTCTTAGCGCAGCACGGCAGCTGACACGTAGTCTCACAAATCTCTTT
CGCGCTAGGTACACGACTGAACTTGAAATACCTCTGGATTTGCTCATCATCACCAATATCCTCAGGTCGCTCCCAAGTCGAGAATCGAACCGACATACCA
ACCCACTTGACCAAGAAAAATGTAGCTGCACGATCTTTCATGCTAATTGGCGCCAGACTTTTAGTCGTGTTAGTGCCCTTAGGACTGCGCTTCGACGTTT
TCTTGTTCACTTTGCCTTCACCATCGGCATGCTCCATAAGAATGTTCGGGACATGCATCAACGAGGTAGTCGTCTTCTTATCTGCGGGGGCACCTTGAGA
AGTTGTCGCAGAAGTGGATTTTGGGGAAGGACCTCCAGATGAAACCAAGGATGGGTCTACCTCAACAACTTTATCCTGGTTGTGAGCATTTTCCTGCGTC
ACCTTATCGGTCTTCTCAATGAATTTTGTGCGCGCACGACAGTATCCACAAAACCACTCACCATCCGGCAGTTCCGTGACTTTAGGGGTGGCACAGTGCA
TGTGAACTTCCCCATCGCATCGATCGCACAACAAAAGCTCTTCACTGTGATCATTGTTTCCACACACGCAACAGCCAATCTGCCAAGGCGCCCACACATC
ATAAAAGTCTCCGGCCTCAGCACGAAACTCcttctggagctgctggtcttctTTGGAGTCTCCCGTAGGCGGGAGCTTTAGCCACGATGTCGGAGATAGT
ATCCAATCGTACAGCCATTtctcgaagcagcgcagAAGTATGTCTGCAACGCGCCAGATGTCAGATCCTTCGGCATTGTACGCTTTGCAGTTATGAAATA
CCAGTCGCACGTCTGAGGCAAATAATGACACGGCTGACGGCCCGACGTAGTGGTTTTCCCGACCAAGTCGCGTAGAAATAGTTCCGAGATCAATTGGGTT
ATTAATGAAATTGAGGTAGTCGGGAACTTCTTCGACGTCAACGGGGTGCTCAAAGATGTCCCCACCCGGTTCTTTCGTCAATTTCGTCACGATGCCCAGC
ATGCGCTCAGGAATCAGGTCGGCGTTTTCCATCAAGAAATAGTCCGTCACACGAGGAAACTTCGGTTCATACGACAGTTGACGACGGCGCTTTTCGATCT
GCTCATCCAAATGGTCGGCTGGGTCCACTTTGTGATTCAAGATTTTCTCCACAGTCAGTTTGTTGGCCTCGAGATCGTCCACTTCATCCAGCGGTTGGTA
TCCATCGCGTCTCAGTTTTCGGTCATACACATGCACGCGATGGAACTTCTGGTATCCCTCGgggacgaagagctccaatTCATCAAACGTAAGCCAGTAC
AGGTGCAAGTACGAACGGCCCAGGAACTTGCACAAGTACTCCACTAGTCCTATCGACTCATTCACTCGTCGTCCAACAATTTGGTCCAACTGCGGATACC
CCACATCCTACAAAAAACAATAACATGATTACGTCATCATGATAAAACATTTTCAGCTTtacagcaactgcagcaaattcaacGTACTGCTCTCAGCTGG
TAGTCAAGTTGCTGTGCACGTTTTTTCTTCTCTGCAATGATAGCTTCTTCACCCTCCGAcacgtcctcttcctcaatGTATttgatcttcttggtgcgAC
GTTTGCGTTTGCCATTGTCCTCGTTCTTTTTGTGCTCATTCTCTTTGCTCTCCACCTTCACTTGTTTCTTCACTTCATCAGTAACAGAATTGACAGGGTT
TGCCTCAGACTCAACCACCTTCACAGTCTGTTGCTCAGCTGTGTCAGTTGACACCGGAGACGCCGCGGGGGCGACCACCTGCTCGCTGACGggcgcagca
tctgcagaAAGTATATGATCAACGTTAGCATAAATCATTGCAAATAATTGCATCGAATTGCACGTTGAAAAAGACGCAGCAATGATCGGAAAAGGCCGAA
CCAACGGTCTCTACCACTCGTTCTCTCTCTTTATAGGATACGTACCAGGCCTGGGGGTGCCGCTGTCCATTGAAGatgcgaagacgaagcagcagcggca
gacCTGAGGGGGAACAACGCCGGCACGTCAGCAGGGCCACAGCTCTTCTCGCGTTCGCTCTATCCGCGCGCAGTCAAACCGCGAAATGGCGCGACCGTGG
TCGAGGTCGCCCTTTTTGGAACTCGTTGTGTGGCGTACATCATATAAATAGACTTGAGGTTTGTATGACGCAATTCAATGAATTGCATGTGGCCAAGATT
AAAATACGATGCtggacatggctacatggACGGTTTGACTGGCATCACCTTGACGAGCGTTGCCAACGATGTAAAATGCAAAATGCACATGTTGCTCAAG
AGTAATGCACGTATATCGCCTAGCAATCGAAGTATTGTCGGTGCAGAAGGACATGAGGAGTTGTGGTAAGCTTAGACTGTCGTCTAGCGTCTTGTTTTCG
AATCTACCAGAGCCGAAGTTTTGCCAAAGAAAAAAACTTCAACagtttgctgcagtggccaTGATTACAGACCGTCCACTTTACAGCGTGTATTGATAGT
CGCGCATTGTGACTCGTTGACTCATCGAAAAGGATGCGTCTTTCAGCACCAGAATCTGCTTACAGATTCTGGTGCTGATGTACGATCGCCGTCACCGAAA
ACGACTCAGCCTTGAACGCTTTTAAGTGCGCATTGTCTTCATGTGCAGACGTTCGAACTATGTTGACCCCTTATCGATGTTTTGTCTTGTTTACAGCTTT
TGAGTTGAAGAACTGTATTGCTCGTATTACGGGTGTTCTCGTGTGCTGCCTGCACAGTTTTCAAACGAAGTTATGCACGGGGAACTCTGCGTTGGAGTTG
TTGCCTTGCAGGCAGACTGAAGTGACAGTCAACGTCAATGGGCTCGAAGGCACCGCAACGACATCGCGCACGTACGATGCTCAAATTTACGAGCGCATGC
GTGTAAACACTGGGAGCTGGTGCCATGCTTTTCTTCGACCACACCCTGATGCAACCGCTAATGCACAAGCGAAAAGCCTGAAAGGAATCGCTGACAGCAC
GTGGTTCCGTTGCAATACCGTGCGGTGCACTCAGAATCCGCTGCATGCGGTAGAATGGGTAAAATGAACACGTAAGGGATGGCACCAACTGACTTATTCC
AGACAACAGGCGGAATGTCAGGCAGAATACAGGCAGAATGTAGATCGTTGCTGATTTTGCTCGCACGATGTTGTTGCGATAACTCCAAGCACTTCACTTT
ATCCCATAGCCCAAACaaacaactgcaacaaccCTTCAAATGCTGTGCAGACAGATTACAAAAGATAGAGCTAGCAATGTAGTTCATTTTACTTGATCCT
TGAATGCTATAAGTTGGTGGCCAGTCAGACTACGTTTTGGGGGTATTCGCAAGGACGAACCAAACGCCGGACACGCCGTGAAAGCCAGACGACGAACAAG
TAGCACACTCTGAGAAAACCGCTGCAAGAAGTCCACacgacaacaacaccgaCGTCTCCCAACAGACAAGGGCGAACCTTTGTTGCAGGCATTGTGACTA
CATCCAGTGCTCCCGTAGGAGACCAAACACAGTCGAACGGCAACCTTTTTGGGAGAACGCAGCATCATCACCACACAAAACTCCAGCATACAGCTCCtct
gcacctccagcacacATGGTACTGACTTGCACCAGTCACCGGCCACTCCTTTGTGCTCCCCGACGCTTGACAAGCACTCAGCAGAAACTTAAAAGACTCG
AAGCTCAGCAGACCGCAATAGACGCCACAACAGCACATGAAAATACCCGAGCCACAGCCAACCGACGTGAAGTAAAGCAGAGAGCGAGACCAGAACACTA
TGTATCAACATCCTGACACACCCCAAGTAGCAAAACAAGGTAACAAGAGGCACCGGAGAAAAGTGGCAACCGAAATGTAAACAAAGTTCACAAACAGGAG
CAGAACGACACCATATCCGCACACCATATAGAGTCCCGTACACACCACTGAAACCCCATcatttcttcctcctttttGTTCACTGAAAAACCCTCGTTGT
CTCCCGAGcgtgaggagaagaaagaggtCAGCAAACAACACGCAACATGCTCGGACGAGGTCTACCCCCTAATTGATCAGCGCAAACTCCCCTAATTGAA
GAGAAGACTCTAATGAATAGagctcctcttcttgctTGTCTAGGGTTACAGGCAGCCCATCGGACCGCCTCCAGTCGATCGCAATGCATACGAAGCTTCA
GGTGTGTGTAAAGTGTCGCCCCGCCCCATGTAAACAATGTAAACAAACCAGTCAACCACTTTTGCTCCAATTGCACTCTACCGCCCATCGCTCTATTCCA
AGGAGGTTCCAGTCCCGCTCCCCCTCCACATCAGCGGCCACAAGACCCAGACGACAACCATTCGCCACCGCGACGTCCCTGCAGCCTGCCGACGAGCCTA
TTAAAGTATCTGCGCGCACGTTGCCACTCGCTAAAAGTCTCCATCATCAGCCACATTCTTGTTTCAAAGTGGCTATTGTCAATTTTGCAATAGAGAAACC
TGTCAAATCGGATTGATTGTATCCATTtttccatgttgaagcgTCACTGTAGCAGATGGCCGAGGTGGCAGCGTTCCCTGCCTTAGCTCGAGCTAAGAAG
GTTTTCTTGCGGAGGAAAGAGACTGCACAACGACGCGAAGTGGAACCAAATGTAGATTCAAGGCCGATTGGACATCATAGAGCTTCGAGCCCGAATAGAC
CTCCAGACCCAGCAAAGCAGGACCCCGTCCACGTCGCAAGATCGGAAACTGTTCGTCGATGCACTGCTTCACTCGTTGCGTTCTGCTCGGATTTCGACAA
GCAATTGCGGCTCGTTGGCAATGATTTATTGCTGCTAAGCACATCAGTGGGGCGAGAATACCAGCGCGAATCGCTGGCCCTCGAAAAGCTgacgtcggag
ctgctgagcggAGAAGTAAGCGGCGTCAAGACTCCACCTAACGATAGCAGAAACGAAAAGCGCAGTCGTGTTCGACTACGCACGAGGAGACCCAACATCA
AGCTCCAAGTGGTTTTCCAGTCTACTGCTCCGAAGGTACCCCCGCCAACGAGTCGTCGAGCTGGTCTACTGGCACTACAAGCAGTGAAGGCGTGTGTCCT
TCAGTCGTACGCCCGCTTCTACCTTTATCGGTGTTTGTACCGTCAAGGCCCAACCCAACTCGTTGTCGCGGTTCAACTCGCCactcgatgtcgtcgatca
AGAGCTTTTCGTCAGTGGTTTCAAGTTATCGTTCAACGTACTAAGTTGCGACTGCGCTGTCGTCGAGCTCAGGAACGCATCGAACGCTCTACGGCCTCAT
GGGCTCGTCGCAAAGCAATTGCTATCCTCGATAGAGAAGGTAAGTACGCCGTAGCCAAACGCTTCCACCAGTCCAGACTCCTAGCAGCAAGCTTCCATGC
CTGGCTGGGCTGGTATGCGGAGCAACCCGAAGGTATTTTGTCTAGCCACAGTCCCAAAACCGTTAAACTGTAGACTTTTCGGTGaagcatacaaaaacca
agatATCCGTCTATACACCCCGTCCCATTCTGAAAAGGTTGTCATTTCGGATAACGGAGACTGTGGGCCTCTCCTCGCCCGTCATGGCGGCGTCCCCCGT
TGATCCCTGGAGCCAGACGACGCGGGCTCGCTCCATCGTGACGTTGGATGGGTATGTGAGTCGTGGTCGAGCTCCGGCCAGTTCGGTGCCTCGCGACCAC
GCCATGTTGCAGGATTTCGCGGCCTATTTGGAGCTGCGACTCAAGTCCCAGAACATGCCAATCTTACGCCGCATCTTCGCCGATTTCCTCAACGAGCAGG
AGAACACACTGGTGCCCATGATGCAACAGGGCTGCACCATCGTCACCCTCTTCCCCATGCTACGGACCAGCGCCCGACGACTGCGTCAGGCACAATTTCT
ACTGGCCAAACCGAAATTCCAACTCGACTCGCGTGGATGCGTGTTTCTCTATCTGCAGTATCGCACGGCCACGAGGAATATGGCACTGTTCAAGCACTTG
TTCCTGGAGTTCGTGGGTCAACGGGAGACGGCGCTGATGGATTTTGTTCAGAGGGGGTGCCAAGTGATCAGCGTCATCCCGTTCGAGCTGCCGCAGATGG
CGCCACCCCCACGTCCGCCACCGCCGGTGCAACGACAAGAATCACCACGAACAGTGGAAATGGTGCCGATAAtacagcagcaagcggaggcggaggcggG
GGAGAAACCCAGAGGGAGGAAACGAAAGGGAGCACTAAACcaaccagctccacctcctgcatcATCGTCAGATCTcgctgttcctgctgttgTTCCTGCG
GAGGATGCCGTGGCTGGGCTTCAGATtgtcaagaagaaaccgaGAGGGGGGCCTGGGAAAGTTGTGGCGAGTGATGATGTTACGATATccgagcaacagc
aagctaCCCCTGCCCATAAGGATTCTAAACGTTCGCCCAAGCGTCGATGCAGGAGTCTCAGAATTGCCTCTGCATCTGTTGGCAGTGAAGTAAGTCAAGA
GAGCAATTTGCCTCCAGTTCCAAGTTCCGTTACTGTTACTAAGCGCGGCAGAAAGCGGAAGACTAGAGCGGTTGCTGTGGCCACAGAACaagccgaagct
gaagctgaaccTCCAAGTCTCGCtgttgcttcttctgcttctaAGCGTAGCAAAAAGCCGGAGACTAGCGCTGGGTCAtcactgcaagcagcagttgctt
TAGCCAGGGAACAAGCTAAAACCGAAGCTGAACCTCCAAGTCATCTCGCTGTGGCTACTACTCCTAAGCACGGCAGTAAAGGGAAGGCTAGCGCTGTGTC
ACCtttgcaagctgcagttgctgcagcgactgcagaagctgaagctgagccCGAAATTGAGTTTGAAGTGGAGCCTGAACCTGAAGCCTTACCAAGTGAA
GCCTTACCAGCTGCTCATGCTCCGCCAAAACGAAGGCCAAGACGAAAGCGCAAGGCTGAGACTGAGGAGCAGAAAGCCACGAATGTAGGTGAAGTGAAGA
CGCACAAGAGAGGCAAGCCCGTCATGAGTGAGGAAACGTGCCGCAGTCAACTGGAATTGAAGCGCAAGATGGAGACTTTCGAGGCACAAATTCCATGGGA
GGCGGTTTATGGCAACTTGCCAGTGCCGTTTGATGAAAGCAAATACCCGGAGCTGGCGAGGAAGCTCGGCAGATTTTGGCGCAAGCACTCGCGCGCTGTG
TGGGAACGCAAGTTCTGGTCCCCAATGTCTCGCAAGCTGAACCTGggcgacttcaacaagagAAACAACCGCCAGCTTATGGCCAGAAACGCTTTCGAGA
AGCTCATCATTTCAGTGTACAAGGAGTTCGGTGCTGCGTTCTTCGTCCAGTTGGACTCCCAGCAGCCACAACACCCTGGCTGGTGGTACCGAGGTCCCGT
TGTGGCTCTGTTTGCACTCCAACAAATTAAGGATGAAAACGCTGTCTGGGACTATGTCAAGAACGAAGCTCTCGAGCGATTCCCGGACTGCAAACTTCCT
GTTCCTCTTACGGCGTCCAACTCCAATGCAATGCGAGCTCGCCACAAACGAGATAGCGAGTCCATGTGGATGGTCAACCACGATCTAGCACCGACTATTT
TGCGCGAGATGGCTGCGATCAAGGCGAAGTTGCCAGCACGCGAGCAGGGTGAGGCCAGTGAGGCTTCGATACAGCAGCCAGAACGCGAGCAAGAAAATGG
GATGACCTTGAGGGACGCATTGGTGTGAGCGCCATCGCATGGACCGAGGTGATATTTTGTATGAAGTCGTGAAAACTGGAAGTTGTGTAGATGTGAGTTT
TGAGTATTTGGAACGATGATTGATTGGAAATTTGGAAATGAAGCATTGGAATTG