Description :
From Genome Similarity Track
Location :
Scaffold_275:858- 10496
Transcript NameFunction/comments
Phypl_g6319conserved hypothetical protein
Phypl_g6320conserved hypothetical protein
Phypl_g6321hypothetical protein PHYSODRAFT_506356
Phypl_g6322conserved hypothetical protein
Phypl_g6323conserved hypothetical protein
Phypl_g6324hypothetical protein

Sequence
9638 bases(100 bases per row)
ATGTAGTTTCGCCGTGAGTTCACGTTTGGAGTGATATGCGTCTACATATCGGACGTGAACGAGTGCCCCGATGAAACACGAGCGTTCCTAAAGACGTCAG
CAAGTTGCCGATGCATTGAACATCCTTCGCCACCACAACGCGCACGTGAGCTCGCTTGCGGTAATCGAGAAGATCACGCGACGCTGTTCATAGGCACGAG
CCACGAGTTCGATTGCTAGTGCCACAGCTCTGTAGAATCTACAGTGTAGATAGACTGCGCGTCGTGATGGCATGCGGCTCATATTTCCTTGACAAATTTT
GATTGTCACCGGTAGCTGGGGACTTCGAGCAAGTACCATAGCCGATTTCAAGAGCACTACGAAAGAGTCTTCGCTCCATCATTCCCAGCCATTTTCTTAT
CGAATTGATCGATATTAATACGTGCAGAGCGCTTCATGCGGCAATATACCTTCCTACCAGCAACAATTTGCGATTTCATTTCACCATCTGACTCGGGTAT
GCTCTGACTCATATCCAAATCCACAACAAGTTGTTGAACAACGCCTGCCTTAACAACGCCTGCCTTATAGTGTTTGTCTTGCTCCGACGCTTCGCCGGAG
AAAACCCGTttcagtttttttttttttttttttttacgaTAAATGGACACCTTCGCTTCGAGTCGTCTGGGTAACGGACAAGTTTTATGCACCCTCCAGC
AAGCCAAACCAGACCTCACTTCTGCGTCAGCGCACTCCTCAGCAAGCCCCCGCGCTGTATTACCGGTAATAGCTAGAATGGAAGTGGTTGTCCTCGGTTG
CgggccgtcgtcgtcggtgccgTCGATGCGCTGCGTGCTGAGCAAGAAGTGCGCCGTGTGCCACGAAGCGCACGCCAACGCGGACTCCAAGAACCGTCGA
CTGAACCCAAGTCTGCTCGTGCGGAACCTCAAGACCGACCAGAACGTCCTCATCGACTGCGGCAAAACCTTCCGTGAGGCGGCACTCCGGATCTTCCCCA
AGATCGGCGTCTCGGCGGTTcactcgctggtgctgaccCACGACCACGCGGACGCACTGCTGGGAATGGACGACCTGCGAGAGGTGCAGGCCACCGTGGA
GACGGTCGACCCGGTAACGAAGGAGCTGTACAAGATCCCACCAAAGGCCATGAAGGTGCATTGCAGTGAGTCCACAAGTCACGATGTCGTTGCCAAGTTC
CCGTACCTGATTGACAATGAGCCTTTGCCTCCGGCCGGGGAGGGAGCGCCGAAGCCGTTCCGATGGACTGCCAAGCTTCAACTTGACGTGATCAATCCAT
GGGAACCGTTCGAGGCTTGTGGCATCCAGTTCCTGCCTTTCCCGGTCATTCACGGCGCCGGATACACGTCGCTCGGCTTTGAGTTCGGGAACGAGGTTGG
TGCGAGGTTCGTGTACATCTCCGATGCGAGCGAGATCCCGGACGAGACGAAAGCGTTCTTGAACGATACAAGCAAACCCCCCATCGATGTTCTGCTGATT
GACGCACTGTACCTGGACAAGTATCACAGCACGCACATGAACTTACAAAAGGTAATGGAGGAGATTTCAACCTTCAAGCCCAAGCGCACGTTGCTTACGG
GTATGAGTCACGACTTTGACTACCCGAAGCACAGCGTCGAGTTGCCGAAAATGGGCGACGAGAAGGGTCTAAACATCGAGATGACCTACGACGGACTGCG
CATCGCATTCCCTTGATCGAGCAACGCATCTTAGCATTAACATGTCGGTGCCAACCCAACACGAACTGCTCATAGCGCCCGCTTTTCCTTCTGTTTCTTT
CGCCAGCGTGATGGAACCTGGAAGTCCTGGGAGGCAAAGTACCTGCCGGACATTTGTCATAGCCTCGATAGCCACCTAAGCTGAGCTCTTCTTAGCTTGA
GTAGTCGGCACCGTCCCTCCAAAGGTATCTCACTTCGTATTTTGCGCCAGCCGTCACAAACGCCCCAGAGTCATCTCGATGGAGGTCGTGATCCTCGGCT
GCGGGACGTCGTCTTCCGTGCCGTCTATGCGCTGTCTAGTTGGCAAGGGCTGCGATGTCtgccgagaagctcaagccAATCCAGACTCCAAGAACCGACG
TCTCAATCCAAGTCTCCTCATCCGCAACCTCAAAACCGATACCAACATACTCCTCGACTGCGGAAAGACATTTCGTGAAGCAGCACTACGAAGCTTCCCC
AAAACCGGCGTCTCCGCGGTTCACTCGGTGGTTCTCACTCACGATCATGCCGACGCTTGTCTGGGGTTGGACGATTTGAGAGAGGTGCAGCCTCTAGTGG
AGACTGTGGATCCAGTTACGAAGGAGCTGTACAAGATTTCGCCCGAACCGCTCAAGGTTCACTGCTGCGAAGACACTGGCCGTGTTGTCCAAGCGAAGTT
CCCGTATCtgatcgagaaggagacTCCTCCACCAGAGGCTCCGTTCGCCACCAAGAAACCATTCCGCTGGACTGCCAAACTTCGGCTGGAAGTTTTCGAG
CCGTGGGAGCCGTTCAAGGCCTGTGGCTTGGAGTTCTTGCCTATCCCAGTGACCCACGGAGCGGAGTATACGGCGTTCGGCTTTGAATTTGgccatgaag
ctggtgcaAGGTTTGTCTACATCTCGGACGTGAGTGAATTCCCAGAAGAGACAAGAGCCTACCTCAACGACGCCAACAAACCACCCATTGACATACTGAT
GATCGACACACTGTACCTGAACAAGCCCAATAGTGCGCATATGAACTTAATGCAGGTGgtcaaggagatcgagacCATTCGCCCAAAGCGTACGCTTCTC
ACTGGCATGAATCACGAGCTCGACTATTTCACCTACGGAGATTTGGTGAGGCAGATTGGCGACGAAAAGGGTCTTCACATCGAGATGCCCTACGACGGAT
TGTGCCTAGCATTCCCTTGCGCTAGCGTGATTTAGCTAACTTCAACATAGGAACATCTTGTGGACTCACCAGAGTACCCCGCTTCGTCTCGTGCGGATAC
CCGTCTATTCAATCGTGTCGGCGACTGCAACATTCGTGTCCAAAGATGAAGTCTCCGGGCTTACACTCACTCGATTTTTCGTTTCAGTCTTGTCAAACGG
CGAAGGAACCAGCAGACCAGCCTCACGCATTATCTCATCGAAGCTTTCGATTTCCTTGCTCAGGGCATTGGCAGcgccgagtgcagcagccgaTGGCACT
GGGAACAGGCGACGGAAACATTTGATCAGATACGGCacaagctcagcacgaatAACCTGTGTGAGAGCAGATATAATACGAGTTAGCTACTCTCATTTGG
TAGTACTTTAGAAATACAAGATCTCGGGCGGAGCATAGTATTTCGTACCTCATTCATCGCACGAACAGAGTCCGTAAGTGCCGCTGCTCTTGCATTTCTC
GGGGTCGTGTTTGTGCCTTCACCAATGCTTTCCTCAGTTAAAGAGAGCAGGTCTAGCCCGTTCTCCTTTACAAAGTCAGCAATTGTGAGCAACATGGTGC
CGATTGCGCTCTGGTATTTTTTGTCCAAACGATTCTGAAGCGAAGAGATTGCGCACAGTCTCAATTCGTTTAGCGACGAAAGCAGCGCGTTGGTAAACTC
GGCCAGCAAAGGAAATGACATCAGGCACCGCGGAGGTGAATAGTCTTCCACGTCGGAGAAGGCTGCCGGATGAGAGACGAAAGGGAAGTTGCTGCCACTT
CCAATAGCTGATGAACGGTACGAAGCAATCACGATCGGTGTcttcgaggacgccgagaaTGAGGACCCACTCGACGCTGTCAACGAGTGCGCGTTCAAAT
TCTCCTGGAACTCACGGCAAGCTGATCGCCAGTACTCTGTCATCAGGTTCAGCACGTGGTCTTCAAAATACACGACTAGCACAGCCCGAAAGTCGACACC
AACACGGCCCAGTGACCCTCCGAAAAACAAACTCTGTTCGAGAATCGTCGCAATCGAGCTGAAGTCATCGATCTTCGGCAGCTGCCTAGGCAAAGCAAGA
GAGTTAATACTTCGTTTTGTTTACATCAAACAAAGCAACACTCTGTGTTGCAACAGTGTGAAACTGTAGAAACCTACGTACTTCATCAGGATGTGGATAA
AGTTTGCGACCGTTGTTGTGGCCCAGCGGCATAGCGGAGGATCCACTTTGCCATCTACATTCTAGAGTGACACAAGCGATGGCACACCGGACAAAAACCC
ATTCGTTAACGATGCCGACATTTGGGAAAGTATTTTCTTAGCAGACGTACCTCGCTGCCGAAGATTGCCGAGTATTGGGTGATCATGTCaaaccagctcg
tccgctTGATGTCGATGACTTGGATAATCTACAAGCGGTGACGACGCAAAAAATCATCAGGAAAGGCACTAGCTGCACGTATATGATGGACAGGTTGGTG
CGCATACATATTGGTACGGGTCGGAGGACGAGATACCTCGACTCAAGGACGACAGCCACACATTTCTGCACGCAAGGAactcctccttgagctgctttTC
GTACTCCAACGATCccacagccgcagcaccgtcCTTCTCAACAAGGCCATCCAGACGTCGGAGATACCCCACGACCCGAACACACAacgccagctgcagg
tcctcgcgaagcttctgcagcaattTCTCGCGCATGGTGCTGGTCATCTCCGCCACCTCGTGCACCAAGCAGTCAATCACCACATTGCGAGACGTGTCGG
CGTTTTCATCAGCCTGGAACGTCTCGTTGGCGAATTGAatcacgtccagcgccgaaTCGAACAGCTCGTTGTGGATGCACGCCTCCAACAGTTGCgggat
ctccagcagctccgtcaacTGACCAAGACACCACACAATAATTGCAATAATTGCTGCGTAAAGTGCCAGCCAACTTGACAGCTAAAAAAACACTTTCTTA
TACCTGCAGATAATGCTCGAAGACGAATTGGATGTCGCCATGCTTGGCCACGACATCTGCCACCTCCTTCTGGAACTCGGCGCAGTATTCTAGGAGCTCT
GGGATGGCCGCTTCGATCTTGGtcgtctcctccttgagctccgccagctGCATGAGAGGAAACAATATATATTGTTGGAACGGGGAAGTAGGTGTCAATA
ATATTTTTCATGCGATCAAGTTGTACGCACGTCGTCCTTGACAATGGCGGCGCACTGGTTGCTCTGGATGAAGACGTGgtagttcttgagcacgagGTTG
CGCAGCTGCTCAGCCGTGTTGTCCGCCTGGATCTGCAGCCGCCAcggctccttcttgagctcctcgagcgagCACGTcttgagcgacgacgccagcatcg
cTTTCGTGAGTTGCTGACAGGATCACCCGGGTATTGTTGAAAATATTTTGCGCAATCTTTTCAATACATGACGTAATATTTTGTAAGTGGGCGCTTTTCG
AGAGCGGGCACGGTACGCTCCGTGGATCACATCAGCCTGGCCGAGGCACCGGCTTGGCGGTGGCGGTCCCTTTGCCTCGATGCTCGTTTTGCAAAAGCGT
TCATCCATGCGGTGAAAATATTTTAGGTAGCGCTCAGTGCACCCTCACGTTACCTCGGTGACGGATCCCGTACAAGTAGCAGCAAGATCACGAGCAAAAT
GTAGACGCGTATCAAAGCAACGCCCTCTTCGACACGATCATGGTACGCGGCAGGATGCACCCGAGGCGGATCGTCAATGTGCACTGAGGGCTttggcgct
ggacctggcgtgaaggagcagcgccgtcatAGTTCTGGTTACCAGCCAACCTTGTTGAAATAATACCCGCCCAGCGGCGACAAACGCGAGCGCCTTAGTC
AGCGCTGACtccagctcgaagcagcCACCGACCCGAAGCAGCAAGCCTGGCGGATCTTTGGGGCCTCAGCATCAGCTGCGAGGATCGCAGACAATCGTCC
CGCGACTCGGCGGTTTCAAACTTCAACCCCTACCCCTTCGTTTACGTGTCACTTGCGACCTCACATATTGGGTCTTCAATATATCTCTTCTGACATAGCA
TTGCCATACTGAAGCCCATATGTGCAAGTTCAGCAGAGACCGATTCAGCTACAGCATCTGCAACTTGAAACGCAACAGCGGCGACACCGTCCTCGGGTCC
ACGCccgcgccgtcgtcactcCTGCGGCTGCACGGCGAACTACCCCACCGCGAGTGCGATGGCATTCCCCAATCAGTCTCCCACAGTCGATTTCGccgcg
caagaagcacaagtcCACGCCTACAATGCTGACCCGTCACGCCCCGCTGCTCTCGCGCTCCGTCGGCGCCAtcagccgccgccacttcgccgccgccgcc
gcctcgaccAGCGCCAAGCGCGTGAAGATCaacggccacggccacgaggcTCAGCAGAGCGGCAAGCTCAGCTACGTGCCCTCGGGTTCGGACGGAAGGT
TCTACATCGAGCAACTGTAAGTGTGCATTCAAGATCGTTGCAACGTTTCAAACCGACTAACGCTGTTGCTCCCTCCAATGACAGGGACGACCACTGGCGC
TCGGCACTGGCCGGCCAGAGCTTCACGAAGGACGACGTCATTGGCTCGGCGCCTGGCACTATTGTACGCTCCTTTGTTGCGATCTTGTTTGGCATGATAC
GCTGTGATGACTCATTCTCACTGTGACATCGTTGGTGCAGTACCCGAATCCCACGCGGTTCACAGTGCAGATCACGCCCAACAAGCACATGGACTTCACG
GGCGGACTCGAGTTCGTGAACCACAGCTGCAACCCCAACACGCGCATCGACATGGCCGAGAGCGAGGCCCAGGTGTCGTTCGTCGCGATCAAGCCGATCA
AGGAGGGCGAGCACCTGACGTTCGACTACTCCACCAGCGAGTGGgacatggacgagaagtTCGACTGCCGCTGCGGTGCACCGAATTGTCGCGGCCACGT
CGGGGGCGCCAAGTACCtcaacgacgaagaggtgAACGCTCGCCTGCCGTTCTTCACATCGAGCGTGCTGCGTCAGTTGCTGAATCGCAAGCTGACAAAC
TAATTTTTAAAGTGAAGGGGTGGGTGTGCGCTCATGACACGTGAGTATTTCCTCGATGTGTCCAGAGCTCCAGTTCACTTCAACCATTGCTTGATGCGAC
TGCTAGACGCTGATAACGAATAAAATGCACTAAGAACAATTGCCATTCACAACAAAATCTCGCTGACAAAATGGACTTACGAACGCGTGGTGCTTGGAGG
GTATTTGTTGGGGTTGGAGGAAAGCGCCTGCTTCCACTGCTCGACGGTGTTAACCACGCCCGTGAATACTTGCTTGTCCTCGATGCGGACACGAACTGCG
AACGACAGGCGAGGGTTCGACTCGGTCTCCGTCTCGGCCAGGATcgcttcgtcctcttcaaGTCTGTTGAAGCCAGAATTCGACGGTTAGTTGAGCAAAC
ACCTTACCAACCCATTGATACTACAGTAGTGCACGTACGTAGTCCGATAATTATCGAGCTTGCGCCGGCAGGTGCTCTGCAGGTTTTCATACACCGTCAA
TTCATTGCGGACGCTGAGAATCGACTTTTCGAAAGCCTGTAGCGCCACAAAACAAGTCGGTTAGTTGCCGGTTGAGAACATCAAATTCCTCCGGATACCA
GCCAACTTACCCTCTTGTACAGGCGAATTTCCTGTTCGTTCATCAAGATGACTCGCAGAGTAGCGAACAGCCTCTCGTCGACATCATTTTTGAAGAGCGT
GCCGCAAAAGTCGTACGTCTGGTTGCCGGTGAGCTCGTTCGAGTCCAGAAccgtctgcttcagcttcagaTACGGATCGTTCGGTGGGATCTTCATCCAG
AAGTCCACCGCCCGACGAGGGTTTTCCTTTGCAACGAATCCGTAGGAAtacagcagcttggcgttcgaGTACTGTCCGTAGCTGATGTGCAGGGGGGATC
CAGCCGCGACTTCCTTCGGGACATGGTGTGTCAAcatctgcttctcctcgtcaaACGAAACgaagtcgtccagcgtgttACGCAGACCCACGTCGTGGTT
GAACATATCCATCGCCGGACACAGCACACGCAGGTACTTGTCGCCTCTGGTCACTCCAAACGCGCGGCTCCAGATCACGCTCATGGCCCACATGTAGTCG
TCCACCGTCAGCGTCGGCAGTGACGCGAAAATCTCGGGAAAATCCTCCGTCACCGCTTGGTGGATGTTCTCAAAGTCCCTATGCAGATGCTTCGTCATCA
GTtgcgtgagcagcagcacgttggtGCCCTCGAGttccttcagctccgcgtccGACCAGAAGACCGGCAGGTCGAACGTAGTCGGCAGTGACGCGATGAA
CGGGGCAAAGAACGAGTCGTCGCTTTTGCTGCGCTCGTGCatcaagtgcagcgccagcacctcgtcggccGGGACCTGCGGATACTTGTCGAGCACGGGC
GCAAGATCCGATTGGGCCGCGGACTCGGCGTTCATCGTGAGCTTGAACGGCACCCGCAGCGTCACTTGgccgctggccagcgcctgcttggcgAACACGC
CGTGGCCCTCGAGCGTGCCCAGGTACCGGATGTCCAGCAAGCTGTCGACGCCTCCATGGGACTCGAGCCACGCCAGCAACGCTGTCACGACCGCAGGCGA
GCTCATGAATACGATTATGGCTACATGTCAAACCGATGGCTACGGATTCAAAAGATCAATTTTGACAGTTTACTATAAAGTTTGAGGGTAGTCTGGTTTC
GGTGGTCGTATGGTACagggcaacttcaaggcAGGCCGGCGTCGCGCAGTAGGTCGCTCAGTATCATGCGTGtgacccgctgctgcagttcctggtCTTG
CTGGGTCTGTAGTGACGAGAGGATGGACGAGCTCTTGGCGCGGGAGATTGGCGTGCGAAGCAGCAAGGTCGGTCGAGTGGACCGGACTGCGGCCGAGAGC
TCCTCGGTTGTCCTGCTGAGGTCGGACTGCACCTTGGACACGATGCTGCTCACGTTCGACGCCACGCAGTTCTGCGCCAGCAAAACGTCGCCCGTGAGTC
CTGTTGCAGCCCCCGACTCGTCCGAAATCAGCTGCAGTTGGCGCTCTAACTCGTGCTCGGCCTGCGCTCGGatcgcgagcagctcgtcgattTCGACTCG
GACATAGCGATGGATGACCGCGAGCATCGAAGTGTCGTCGAGCGGGAGCTCACCCGACGATGACTGCTGGATTGCACAGAAGAAACCGCGGGCAAGgtct
tcgacggcatcgtACAGTACGTGAGCGGTGGAGTCGTTTCCGACGCCGATGCTGTTGAACGCTGGGAGCCAAATCTATCGAACACGACCAAGCAAAGAAA
GTTAGAGAAGAACCAGCACACGATGGAGACTTTGTTGACGTACCTCTCCATCGACAATCTCAAGTTGACCCACGATTCGTTCTGTTAGGGCACGATCCCG
AGAGCTTGGGTCTTGACTGGCAACACGCTTCGTCGATTCGCGAGTCGTTTTGACAACGGTGGGAGTCGTAGCCCCAGACTTGATACTGCGTTGGGCTGTA
GGTTGTGAGCTGCCGGtagatggagctgcaggttgcTGACGAGACCACAGCTGTAGCTCCGAGTTTACAATTTCATCGAACACTGTGGCAAATATCGTGT
CTGCCACCTGCTCCGTTTGAAGCGCCTTGTCAGAGTCA