Description :
From Genome Similarity Track
Location :
Scaffold_626:858- 3425
Transcript NameFunction/comments
Phyta_totarag9760peptidyl-tRNA hydrolase, putative
Phyta_totarag9761hypothetical protein

Sequence
2567 bases(100 bases per row)
CAGTAATGGAGGACGTCGCGTGGAAGTGCACGGCCGCGTTCCTGCTGGGCGCCGCGACGCACTACTTCATTTCCTCACAGTTGCTGCGCGATAATACCCC
GTCCACCAAGGACTCCAacactagcagcagcaatggcaacgATGACGCTGCCTCCGGAGCTTCGTCCCGATCTTCCTCGGGCTCCTCCGACGACTGGGAG
GGCGAGGACTCCGTGAGTTGGGTGCCCCACAAGATGGTCATGTGCGTGCGCACGGACCTGAAAATGGGCAAAGGTGGGTACTGAATCTAGGCAACAAATT
TGGGCAAGTCCAGTCATTTATGACGACGGGGACTTACTGGTGTGTTCAGGCAAAGTCGCGGCACAGTGCTGCCACGCGACGTTGGGCGCGTACAAGCGTG
CGCTGAAACGGACGCCGGATGCCGTTCGTGCCTGGGAGATGCTGGGCCAAGCCAAGGTCTGCCTCAAGGTGGAttcggaggaggagatgctCGCTCTGGC
cgagaaggcggcggagcGCGGACTCGTCAACTACGTCGTGGTATGCTTTTGAGTGAGTGGGTTCTGATTGAGTAGATTTGAATTGCTGATGGGTTCATGT
TGTGTTGGTGGCAGGTTGACGCCGGTCGGACGCAGATCGCACCGGAGAGTAAGACGGTGCTGAGCATTGGCCCGGCGCCGCTAAAAGCTATTGACGAAAT
CACTGGCCACCTCAAGCTCATGTGAGCGTGGTGCAGGAGCTTGGAATCAGGGAAAAGAGACGTTTGCTTGCTCAATGAAACCGGGGTTCTTTGTTTTACA
TTTCTCTTTTCCTTCCTGTTTTAATGACAGGGTGGAAGTCAAAGAGCTCTGCGACTAGAGCGTGGCCACGGTATCGTACGCCGTGCGATTTTTGAGAATA
CCAGAACGTCTGAGCGCGAAAACGGTCAACGCAACGCACGCTACTGCAACGACGGTTGCTAGCGCTGTCGTTCCAATCGTCATCAACACGACTTTTGTTG
CAAAATCGTTCTGCGAAGCACTGGAaccagatgaagctgctgctaccacGTCAACAGGCGACGCTGAGGTGTAATCGTTGCCCTCTACCCGACCAGCGCT
CATCATTTGGGCAGTGTCTACGCAGGCCAGAAACTCGCCCTTTGTAGTCCACCACTTCAGCGTGCACAATGTCTTCGCATGACAGACTGCGTCCTTGCAA
GGTCGAGCATTGGGCGAACGGGCCTTCATGTTCCAGTAGTAGTCCTCCACCAAGCTTACGTTTTGTTCTGCGCGTTGCACAAAAGCTGTAAGCTCCGTCA
AAGATAGCGACTTAAGGCCGTACGCCTCGCTCGCCTTGAACAACAGCTTCCAGTCGAGCTGAGGCTCGCTCTCCGCGATATAAGAAGCGTACACGGCGTA
GTCTAGCACCTCGTAGGTTTCGGTATCATAGTCCCAGACCATGAAGGACGGGTTGTTTCCAAAAAGTGGCGAGATCGAGCCCGTAATATACATTGGCGAC
AGCTGGAAGGCGTCGTCCTCTCCTGTAGCCCCATCAAGTGACATCACGGGCACACGAAACTCGACACTGTGCACGTGGCCGAAGAACTGCGCCTTGATTA
CGTCGGCATACTTGCCAACGATGTTCTTGTACTTCACAATGTACTTTGTGTGCCACTGCGGGTTTCCTCCGTACGAGTCCACGATCGGAGCAATGTGACC
AGCTATGTACGCGAACTTGCCAGCAAtctgcagctcagcaagcGTCTTGTCTAACCAGGCAAACTGTCCGAATGGATCCGGCTGCTTCGATGTGTCCGGC
AAATGACTTGGCTGTGCATCAGCAAACAAAAAATcatcagcaccaacgtcCCCACTCAATCTTTAAGAGTTGCAGATCTGACCTACCGAGTATGGCACAG
TATTCAGCGTGATCACGTCCAGCTTGTCATCCAATGCATAGCTCAAATATCCACGTCgattgagcagctccatgttAGCAGTCGACAGCGAGTCCTCCCA
TACCTCCGAGATGAGCTCAATGGACGGGttcgtctccgtctccggGTCCGTCACCTCCATGTGGTAGTCCGGGTCTGCCATCAATAATACACAGCAATTA
GCCCCTCAATCTCACAAATAATAACAAATAATatcttttcttcttcttacTTCCGTCTGCATTGCCAATGATGGCTGTAGCCTCCAGCATTCCTCCGCCC
TGACTCTTTGACGGATAATAATTCTCCATTGCGTGGACATTTGTCTCCACGGCTTTAGCAATGTATTCATCGGTGAACAATCCGTGTGCTGCATGGTCCC
CCGTGTACAGGAAGAGCTCCGGGTCGTCCACCACGTGCTCCTTGGCGAAAACCAGCGCAGACTCGAGGAGTGCCAAGGGCGCGTCGGCAAAGTAACGGAT
GGGGATGCGAGCGTTGTCCGCGGAGGAGAAAGACTCGGAGATATTCAAATGGACGTCCGAGAAGTGCAGGGCGCGGCCTGTAGACGCCGCAGACGTCGGT
GCCGAGagcagcgcagcgcagcCGAGCAACGTCAGCCCCAGCATTGTCAAATCGGAATCGGAGACTT