Description :
From Genome Similarity Track
Location :
Scaffold_169:8578- 14997
Transcript NameFunction/comments
Pytul_var.sporangiiferumsnap-pug3_contig_169-abinit-gene-0.37Protein 3.4F-V

Sequence
6419 bases(100 bases per row)
ATTTATACAGTTTTTGCTTTGAGTCATCAACACTTGTTATATGTCAATCACCACCAACCCTAGACTATTTGTTACAAGCGAATACTGCATGCTGCTGGTG
TTTACAACCTACTCATAACGCTTTCATGCGCATTGTTCTCACGCGCGCCTCTGTCGAATGCTATCTCAATGCATGCACAGCCGTATCAGTCTGCCATGAG
GCATGTGAGTGACCCACAGAACGCCACAAACAGATCACCTGAGTGGATTGTTGTTAAGTGTGCATGCGTCTCAAATTTAACGCATTGATGATGCTTTCCA
TTCCGATTCTCGAACCTTTTAGACGACGAATGATGGTCATCAACCCATCCACCTTTGGAAATGAAGCACGTAAAGCTACATCCGCGGCGCGTACACCTTG
CCGTCCTTGCCGCGCAAGAGCCCGATTTCTTGCTTCAGTGCCTCCACTTCGCGCGACTGGAGCTTCACTAATTTCACCAACTTGTTGCGCTCGCGCATCT
CTTGCTCGAGAAGCTCCGTATCGTCGTTGAGCACGCTTTGATTCACGTTCGCTTGGTTGAGCTCTCTCTCAAGCGCAAACTGGCGCTCGTTCAGTTCAGC
AATGCTCGATAACAACGCCGTGTTCTGCTCCGTGGCCTGGAGGATCTGCAGCTTAAGCTGTTGCTGCGACTGCTTGGCCTTGAACATCTCGCGCTCGCTC
TCGATCTCTTTGACGCGCACCTTTGCCTGCAATTCGTTCAGCTTTGTCGTATCGCACGCTTTGTCAAGCACTTCAATGTCGACCAGCTGTCCGAATTTCA
GCAATTGGAGCTGCTCGCATCGGTGCTGGATGTCTGCAATGGCCTCCTCTTGCACCTTCTTCTCCTTCGCAAGAAGATTTTGCTGTTTGTGGAGATCTTT
GAACTGCTGGCGAAGACTCTTGTTCTCCTTTTGCAGACTATCAATGCGTTCGGCGAGATTGTCAAATGACTGCATTGTAAATACGAGGCAATTCGCTGAT
TGCTCGGGAACTTCCCATTTCCCATCAGGTCGCGCTTCGAGGCAACGGATCTGGTGCTTGCTCAGTGCAACGACCACATCGAGCTGATTGAAACGTGTCT
GCTTTTCGCTCTGGAATTGCTGAATATCGTGCTCTGTCGCCTGGAGCTCCTTGTCAATTTGTCGCTGCTTTGCGACCTGGCGCTCGTTGCTCTTCTTGAG
CTCTTCCATTGCCTTTGTCAGATCGCTCATCGCATCGTCCACATCCGCGCGCTTTTCACGCACAGCTAGCACTTTTTCATAAAGCTGCAAATCGCATCCT
GGCGGACACACATCGTCTTCGTCATCATCGTCGTCATCGTTCTCGTCGTAGTCGTCATCGTCTTCTTCTTCGTCGTCGTCGTCATCATCATCGTCCGCGT
TCTCGTTCTCGCGGCTCGGATCGCTCGCGTCTCCGTCACCTCCGTCTTTGCCGTCTTTGCCTGCGCCACCCGCGCCAGGTTTCTTCTTTGGACGCTTAAT
TTTCTTCTTGAAGATCTTTTGCAGCGCAGCAAAGTTCGGGTGCTGGGTGCCTCCATTATTGCCATTCACGGTCGTCAAAAATTCGCTCTGGATCGCTTTC
TCTTGCTTGCTCCACTCTTCGTGTTCTTTCTTCTTGCTGCTCAGATTCTCTTGAATCTCGTTGATTTCAGCAACGATTTGCGCTTTCTCACCTTTGCTTT
TGTCCAGTTTCGAGCTCAGAAGGTTCTCCTTGTTCTCGAATTGTTCCAGCAGCACGAGTTCACTCAGCAATGTGAATAATCGGAGCTCGCATTTTTTTAA
AATCACTTCCAACTTCATCTTCTCACGGCGCAAATGCGCGATCGCGTCGTCGAAAGCACGAATCTCATCCTGCTTCTTGCGCTCAATCTTCACAATCTCT
TGCTTCATCAGATACACGCGGACTGCAGCATCGTCAGCATCCATGTTCTTTTGCTTTGGCGGTCCTTCCTTAGTGGTGATATTTGTGAACGAGTGCAAAG
GAGCAGAAGAGAGTTCATCCAAGCACAAATGGCGCACTTCAAGCGTTCCATTCACCGCATTTCCTGCTGCTCCGATAGCCTCGCTTGAAATTTGTAGCTT
GCGAGACAACGTTGCAATTGATCGATTCATCGACCCTTTGCGAGAGCTACTCCCGCTTTGGTCGCCTGAGCTGCTGCTAATGGAGCCGACTCGNNNNNNN
NNNNNNNNNNNNNNNNNNNNCCCTTGTGGTCTGCAAAAAGCTCGTCGCAGTGGAATGTGGCAGCACTTTCTTCTCACGCAAAAAAATCTCAATGTCGGCG
TCACTCACGCGCTCACGTTGCTCGGGCCATTCCCGCAAATCAATTTCCAGTGTCTTCTTTTGCGTCGCGTGGCGCTCTTCCAGCGCGAGTGCCTCGTAGA
GCCCAACTAGCCGTGCTTGATCGTGCTTCAGCTCATTAATCAGCAAGAGCTTGAGCTCCCGCAATTCCAAGACCTTTGCGTTGAAGCCCAGCCGCGCCTC
GTATAGTTTTTCTTCTAAGAGAGCCATTTGCCTGCGCTTCTTGGCTGCGTTAACGCGTTGCTCTTCAGGGACGACGTAGTTCGAGGCTGATTTCAGTTTG
TAGTCCCCCATATTGCGCTGAGCGAATGCAATCGCAACGATATCCCGCGGATCATCCGCATCCTCACCAGGTTTACTGTTCATCCACTGGGTCAGTCGGT
CCTTTCTGTCAGCGCGCAGGCGCTTTCGAGCTTCAAAGCCATGCACAGAGGACGAGGAGCTAGAGCTATTCGATGTCGACGCGTCTTGCAAGGAAACAGG
AGCGCCTGGAGGCAATTTGTCAAGTGTGCTATTCCTTCTCGGCAACCCCTGATCAGCGCCGGTTTTCAAGCTTCCACCGCTTTGAATCATCTTTCGTTCT
TCCTCCTTCAGTGGAAATTCGTCATCAAGTGGAACATTTTTCGCCATGATGTGGAGAACACTAGGTTTGCGGAGTACTACTCCATGCCCTGCAGCTGGAT
TGTTTTTGGCGCCGCTGAGGTCGTTCATCGCGCTCGTTGATCCTTTCTTTGGGGCGCGTCGTGCTTCAGATAAGTCGTTCGTGTGAATTTCATTCAGACG
CTTCTGCAAGACCACTGGCATTTTCATGGTGCGGAACGACTGCACGCTCAGCCCATTTTCAAATGCATGGAGCGTGATCAGCTCTACTGCAAGTGGACTC
ACATACGTCTCTCGCATCTTCATCAGCAACAATTCCTCTCGCTCGACTGCGTAGGCGAGCTCTTTCCGAACTTCTTCGCATGCTGCATCCCCCATTTTGG
TCAGCAACTCTCCGTAATCGAGATCAATCTCCCATTCGTCGTCGTCCAAGCGGCTCTCGGGTGGATACGTCGCATTCAGAGCCTTCAGCTCTTGCAACTG
CTTGCGCATATACTGCACCACGTCACGCGTGCGATCCTGTTTGCTTTTCGTGGTGTTGGCTTTTGCATCTGCCTCGCTTTTCAGTTTGGCATCTTCAATC
GTGTAGGCATCCTTGGGATTCTGAATATCCGGCACCTCAAGAAGGTTCAGTAGACTGCCAGTCGGAGCTTCTTTGTCGTCTAAAGGCGAAGCCGCCTCGT
TGAGGCCCATTTCACTGTCTGGATCGCTTACAAGTCGAACAACTCCCTGGAAAATCTCGTCATCTTGTGCAAACGGCGGTGAAGAATCGTCCGAGGCTTC
CAGTTTGCTAGCTACGTAGCTTGAGTACGCTTTTGCTCGATGAAAGGACGGAAGCGACGTCAACTCGTTCCCTAAAGAGTTCACGGCATTCGTCATGTTC
CCAGTATCATCCTCATTGTTCTTCCCATCGGCTAACGCCTTTTGTAGCAGATCCATCTGCGTCTTTTGCTTTTCCATGGCCTGATCGCCGACGATATTCG
CTTCTGCCAGTAGCTTGTCGTACTTGTCACTCAAGATCCTCGCCGAAAGTTCCAGTTTCTCGTGATGGAGACGACAAATACTTAGGTTCCCATCACAGCC
AGCTGCCAGCACGAACGAATCATCAAATGATAACGCAAGTTGCAGCCGACCACCGTTCCCGTTACTCTCAGAGGCTCCGCTCGAATGAGTCGAGTAGTCG
TGGAACTCACCAGTGAGAAATGCGTGCGGTTTGCTGACACTGCGCAGTTGAAACTTGCCGTTGGAGAGTCCACAGAGCAAGACCTTCTTGGAACTCGAAA
GCGTCACGCCAACGATATGGCTAGACTCCTCCGAAGCGAACTCTTGGAGCGGAGTTGGATTCCCATACCGATACATGTACAGCGCTCCATGGAAGGGGCT
CTGGCAACTGAGATAGATGGTATCATTGGATGCGTACATCGCAGTCCATGCCAAGGGGGATGATGCACGCATTTCGACTTGAAAGTTGTTGCGAATCTTC
TCTTCGACTTGGGGATTCCCAGTCGGATTGAGCGCTTCCAAGACCTCCATTTCCTTCACGGTCATGATCCGGCTTCGTTGAAACGGTGAGTACTCACGAC
TTTCCAAGTGCAGCTCGTAGGATTCGTTTTCTTGAGACTCTGCCGCAGCGTCGTCCATACGCGGCGACATACTCGCACTTCGCTCTTTCGGCGCCAGCCC
GTTTTCAGATAAGAGAAACTCGACCACTTGACCATCTCCGAGCGTGACGAGCAACGCGGCGTCATCAGATCTCCAACAAAGCGAGCGAACGCTACTGGAC
ACGCGCTGGAAGCCCAAGGGTTCGTATTCTGGTGGATATTTCGAAAATTTGGAGGTTTTGGCGTTCGGAACAATTTTGAAGATGAAAAACGTGTGGTCAT
CGCTCGCAGTCGCGAAAAAGATGCCAGAGGTTGAGTACGAAAGGCACGTCACGCGTTCGTGGTGGGGTTTAAACACGTTTGTGCGAACCCAAATGCGCTT
GGCTAGATCCATCAAGAAGACTCGAACCAGGCCATCGCTGAACCCGACTGCCACCTGACGACTTTTCACGATCTGTTCGGTGATCAGTGCTCCGGAAGTT
GGGACCCACGTAATAGAAGTTGCTGCAGCTGGAGCGATTGCAGGCGTCAGAGTGCCTCCACGTTCAGTAGCTGCATTGCTCGCTGATGATGACGAAGTCA
CGGTTCCGAACAAAAACTGCTGCTTGACGTAATTCCACGCGCGAATACTTCCATCTTCCCCGCAGGATGCTGCCAAGTGCTCGTACGGAGAGCAAGCGAT
CCCTGTCACGCGACCCGTCTTGTTTGGAAGATAGCTGAGCTCGACGTAAGACTCCTCTCCTTCCATTACTAGCAAGTGCACGCTGCCTCCGCCGTCTTGA
ATGAGGTACCGGGAGCCACTTTCTTTGATCACTGAACGGATGTCCATGAGCGGCTCGATCAGAATCTGCTTTTTCATCGGCACTAACGCAACGGTATCAT
CTGGTGGTGCATCGGCGCGATCGATTGTGTCGAAACTCCAGAATCTCACGTAGCCATCTTTCCCTGCCGTCACGATCTGGCCTTCTTCTGGATCATAGTC
AACGACATTGATGGCGCCATTGTGTGGCGCATGGCGACGCGACGTCAGGATCTCGCACTTGATAAAGTTGCCGTCCCAGAGCAAAAGTACGCCGCGCTCG
GTCCCACTGAGCACTTTCTTATCTGGAAGCACACAGAACGCTTCGATGTCACTTAACTCACTTTTGCCGAACTTGCCGATATCTCCCTGCAACTTGAGAC
CAGTAAACGTGGACGCCATTCGCCACATACGAATATGGCCAACACCGCTGGTCGTGAGGAAGCCACTGTCATTGGGCGCGAATTGTACACTGAATACGTC
TTGACCGAATGCCTTGCAGCGTAAAATCGTCTGCTGTTGGCGCCAGTTCCAGACTGTCAGGAGGTAATCAGGGGCTCCGCCAACCGAGGCCAATTTCTCG
CCATCTTGACTGAACACAATGCTGCTGTATGAAAACTCGGTCCCATTTCGCAAGACACCACACACCTTGGCGCTTGGATATCTGTAAATCGTGATGTTGG
GCTTGATTCCTTTTTCACCGACCGCAAAGAATCGCTTTGATGGATGCACAGCGAGACTCCCGATGCCACCACCGCCAAATCCAAAGAGATATCGCCGCTC
CAGGACGGCATTCCTTGGTTCATTTCGCTGCTTGTTTTCAGTGCTGAACGGTGCTAGCGTTAAAATTTGGACAGTATTACCCGCAGCTGTAAGGATGATG
CCGCCATGAACGCCGTCTTTCCTGGGCTCGAGGAAATGGATGATGTGGCGCTTGCCGGTATCCAGACCACAGATCCCGCTAAATATCAGATGATCCCTCG
AGATTTCCCACTTGTGTAATGGCCGAGCAAGCTGATGATTTTCGAGATTTACGATTCCATCTGCATCAAGGAGCGGGATCTCTTCGATGCTACCTGCCTT
CCCTGGGCTAGCGGAGGCA