Description :
From Genome Similarity Track
Location :
Scaffold_546:8577- 10309
Transcript NameFunction/comments
Phypl_g9304hypothetical protein

Sequence
1732 bases(100 bases per row)
TACCGTCGACCAGTGTGGAATTTGTACAGAATGGCGGCGAAGGCCATCTCAAATGCTGCCGCGTTGGCAACCAGCACCGCCATATTTCTTCCGATGTGGA
CTTCGTCGGGCACGAATttggccagcaccgcctGACTCGGCAGAGATGCGTCATCGCCGAACTGGTTGAACAGCAGTGCCTCGAAGCTGTAGGACAGAAA
GCCCAGCCGATGCGCCCATCGCCAGTAGTGTGGCATGGCAGGACCGGGTGCAAACAGCCCCATGACCAGGATGAACCACCCGAAAATCGCAGCGCCCAGC
GCCATCCCCATGATGAATTGGGGTACAACCGCAGAAATGAGGTGCATGAGGTTCTCGGCCACGATGAGCGATAGGAACACGACTGCAAGGAACACGCCGT
AGGAATTCAGGCCCGCCAAGTATCCTACGAGCAGCGTCGAACTCAAAGCGATGAGGAAAATGCCCGGTAAAGCACCCAAGAAGTTGGCCACGACGTAACT
GAGCACGTTCAAGCCGCTGTTGGTTCGTTCGCGGAGGAAAACGGCGCGTTGCTCGATGAAAAATGGCAGCACGGCGATCGACAGAAAGACGAGGTAGATG
TTGACGTAGGTGAGCAGCATGACGATGTCGGTGGCGACAATCTTTGGGTTGGAGGATAAGTACATGGTGCCTACCATGAACGACAGCACCGTATAGGTTA
CGAGTCGGATCCAGTAGATGCCGGGGTTACGCAAGTTGTTGAGCAAGTTGCGCCGGAGTAAGACCGAGAACTGTTGAATTGGTGACGAGTGGCGGAGCTC
CGTGGATCTGGTTACATGTAAACCTGCTGCATCGGTGCGAGTAGCGCTGAGGACGCGGGCAGCTACAGTGCTGGACGCGTATCCGTTCAGGAGTTTGTCG
ACGTCTCCGTGGCCGTCGAAGTCGGTATTGGCGAGGTCGATAAAGTATTCGGCGGGGTCTTGGTACGGCGGACAATTGTAGCCGAGAGATGCAAAATGAC
GGAGGATTTTCTTGCGTGGGCCGAAGTAGACGGTCCGACCAGCAGTGAGGATCACCACGTTCGTGAACATTTCGTATACGAGGGACGAAGGCTGGTGAAT
TGTACAGATGACGGTTCTGCCTTCCTTGCTCAAGTGTGACATGAGCTTCACTACATTGTACGTCGATGCAGAGTCGAGCCCCGACGTTGGTTCGTCCAGC
AAAAGGATCGACGGGTCCGAGAGCATTTCAATCGCGATACTAAGTCGCCGCTTCTGGCCGCCAGAGATTCCTTTGTGAAACATGTCGCCGACCATTGTGT
CCTCGCATACGCGCAGCCCCATCTCGTCAATAACACGTTGCACTCGCTTTTGGATGGTAATGGCACTGGTGCCGCTAGAAATCGTCAATCtcgccgccat
ctccagtGTCTCCAACACAGTGAAGGACCCGAGCAGAGAATCCTCCTGCGCAACGTAACTAGACACGACTCGGAACATTTTCTCGCTCCGCTTATCTCCA
TTCAGAGCGATGTCGCCCTTGATTGCACCGGAGCAGGTCCGGTCGGCCAGGATGTCGAGTAGTGTGGTCTTGCCGGAGCCGGATGGCCCCATGATGGCGG
TGAGTTCTCCCGGTGCACACCGTCCGGTGACGTCCGTTAGGATCATTTTCTTCCCACGAGGGCAAATTTCACTCTTCTTGGTCTCGACAGTGTACGAGAG
ACTACTCCAGCTTAGTGTGCACGGATTCGACG