Description :
From Genome Similarity Track
Location :
Scaffold_4:857320- 862531
Sequence
5211 bases(100 bases per row)
CTTCCTCTGACGCTAAAGCTACGGCAGCCCCGCTGCACTTGGTAGCACTTGTAGTCAATCCCGCTCCTGAGTCGGTTGACTATATCCTCTGCGAGGATGG
AACACCCCGTGTTCGCGAATTTGCCCCCGGCGCAGCAGCACGCGCTTACTAAGCTTATGTCCTTGCTTGGCCCGGAGGGCGTGGCTCATCTTGCATCGCA
AGGTCCAGAGGCGGTCACTGCCAGGCTGGAATCGTTCTCCCGCTACGAGAACGCGCTCTTGGAGCATGTCCAAGAGAAGATGAGCGCCGCAACGGCGGCG
GCGTCGATGACGCGTGAAGAGTGTATGAGACTGAAACCGATCATGGTGAGCGTAAATACCTTCGAGGGGAATGATGGAGAGAATCTCCTTCTCTGGACCC
GTGAGGTCGAGATGGCCATGGGATCGGCCGCGCTCCAGTCTGAGCATCAGCGCGTGGCGCTGGCTATCTCCAGGCTTGGAGGTCGCGCTCGCGAATAGGC
ACTAACGTGCGGCACGTCTGTTGACGCTGCATTTCCCACTTGGGATCAGCTGAAGCAACAGCTTTCGCGCGTGTTCGCGCCGCCTAATCAGGCGTACCGT
ATCCGGTCAAAGTTCCTTGCTACCCGCCAGGGTAAGAAGGTTTTATTGGACTATGTCCAAGAGTTGAGAACTCTTATCGCCGGAATGGCGGCGGACCCTC
TTCCAGAACTGGTCAGCGTGACCGTGTTCATGGAGGGACTTCGTGTGAGCGCAGCTCGAACGGAAGTGTTCCGTGTACACCCTAACTCTTTCGAAGAGGC
GGTGAATGTGGCATTAAATGCCGAGCACAACTTCAGGTCGGCGCGACCTGGTTGGAGCGCTGGTAGCGCAAGCTCTTCGAGCGGTCCAGAGCCGATGGAC
CTCAGCTATGCTGAAGATGACGAAGCGGAGCTTCTTGCTGCGGAGCAGCGCGCCGGCATCCGCCGATGCTTTGTGTGCAATAGCACTAAGCACTTGAGGG
CCTATTTCCCTCTGCGCAAGAAGCGCGAGGCTCCGGCGAGCCAACCCTCCGGGTCATCGCCGGGAAACGGCAACTCCCAGTAGGCGCGGGGCGGCCTACT
GGGGAAGAACTGAGTTCTGTTGTGCCTCGAAGAGGTAGAGGGCAACGGGGCTCAGCTTCGAAGAGAGCTGAGCTCTCTTACGAGAAGCGTGTGTGCAAGC
CGGGCTTGCTGGTCGTTCAAGCCAACGTGAAGGGCTTTGCAAAGCCATGGAGAGTCTTGATTGACTCGGGAGCCTCGGGCAACTACGCCCGTCGCTCCAC
CCTAGAAGGGAGTCAGCTGTATGCTGAATCACTGGAAGTGCCAACGAGAGATACGATCTCTGTCCGTCTCGCGACGGGGACACTGGTAACTGTGTCGAAG
GTCTCTGTCGACCTTGGAGTGAAGTTTGAGAGCTTCGATAGCGTGGAACGCTGTTTGGTCTTAGACCTGGATGCGAGGTATGACCTCATCCTTGGCATGG
CATGGCTGGAACGCCATGAGCTATGGATCGACTGGAAGTCGAAAACGCTGGGTGCGTCGCACCCTGCTCCTAGTGGAGCTTTGGTGAGTCATGAACCCAC
CTCTGCTAGGAAGCAGAAGCGCTTTTGGCGCGAGCACGAGGCCGAGGCGGCCGTAGTGCTGGACATTGGTATGTCCGAAATTGTTAGCAACGAGGTTGCT
GTTTGCCCTGAGGGCGTACGTGGTGCGGCACGTTATCCGCTGAGTGGTGCAGGTCAGGTCAATGACCAACTGCTGGGTCCTGGTGAGGACGAGCGCGGAG
TGGCGCGTAATCCACTGAGTGGTACGAATCTGGTCGATGACCTACCGCTGCGTGACCCGAGGGTCGCGGTCGACTGCGAGTCGAGGCATCATGGGCGTGG
CCCAGGAGATGCAGGTGAAGTGACACCTAGTTCACTGTGTGAAGGTCGAGGACCTCTTGGCTTTCAGCCGTTTGTCTTGCGAGACACTGTACCCTCTTCG
AGGAGTGATGGTGCTGCTGCACCCGGTGGTGGTGACGGAGATGTCGCCACATCGCCCTCATCCGGCCGGGCTCGGTCGCGGAGGTAGAGGAGAAGAAGAC
GCAGGGCGTCTGTGACGTCTTCGACGTCGGACGAGGTGTCCAGCGTGACGAGCGGTGATGCTCCACGTGATTGCTGTGAGCAGCTGTATACACTCGTGAA
CGAATTGACGGGGGAGGTAGAAGGCGATATCAGCCTTGACACTCTGCCCGCTGCAGAGGCTCTGCTAGAGCTGGACGAGATGTCCATTGCCGAGTTTGGC
GAAGCCTTGAAGGCAGGCGAGCTAGCCGAGGTGGTCCTGCTGGGACCTGAGGAGGAGTTGAATTTCTCATCCGTCGTGGACGACGCGGTCCTAGAGGACA
CCAAGAAGGCGCTGAGCGCAAGAAGTGGATCGGCGATCCTCAAAGATCCTTCGGATCCCTTCTACCCGGTGGTGAAGGAGTATGGAGACGTTGTCTCGAA
AGACCCACCGACGGGCCTGCCTCCGAATCGAGGCGTGTGTCATGAGATTGACCTGGTTCCTGGAACCAAATACTGCGTAACAAGGCAATGGCCTTTGCCG
AGAGAGCAGTGTGACGTCATTGACGCATTCTTCCGTGCGAAGCTCGAGGCAGGGATGGTGCGTGAGAGTAAGTCTCCGCACTCGACACCCACGTTCTGTG
TCAGAAAGCCGAACGGCAAGTGGCGCATTGTTCATGCTTTTAACAAGCTAAATGCGGCCACTATCCCGGCGCAAACGCCGATTCCTCGCAAGGATGTTCT
GCAGAACAACATGGTAGGCTGTACGTTGTACAGCGCGCTCGACTTGGTCGATGAATACTACCAATTGCTCATGAGAGCGAGCGACATTCCGCTGACAGCG
GTGAGTACTCCGAGCGGTATGCTCTAAGAGTGGCTGGTGATGCCCCAGGGGCTGTCGAACGCACCAGCAACGTTCAATCGTCTTGTGACGCAGTTGTTTA
GGCCCCACCGGGCGTACGCTCAAACGTACTTTGACGATATATTCGTCCATAGTCGTGCTGAGCACGGAAAGTCAGACGTGGAAAACCACATTGACCACTT
GCGAGCGGTGCTCGAGTGCATGCGCACTAACAAGTTGTATGCCAACTTGGACAAGTGCGTCTTTGGCGCGGAGGAAATACCTTTCCTCGGGTGCTTCATT
GGAAAGCGAGGCTTAAGGGCAGATCCTGCCAAAGTCAAGGCCATCGTGGACTGGCCGGTTCCCAAGAACCAAAAGGACTTACGCAAGTGGCTAGGCTTAG
CCAATTACTTGCACAAGTACAGCGCAAACTACGCGGAGATGGCTTGGCCATTATCAGATCTCCTTAAGAAGGACGCACCATGGTGGTGGAACGTCGAGCA
CGACGGAGTCTTTGAGGCTGTGAAGGAGAGCCTTCTCCAGGCTCCGATCCTTGCGCTACCGGACCCGGATAGTCCGTTTAGCGTCGTCTGTGACGCCTCC
GATTTTGCAATCGGTTGTGCTTTACTACAAGCAGACGCCGAAGGGCGTGAACGCGTGATCGCGTTTGAGTCTCGCCAGCTCAAAGCTGCAGAGAAGAACT
ATCCAGCTCATGACAAAGAGCTACTTGCAATGAAGTATGCTCTAGTCAAATTCAGGGTACATCTGCTAGGCTCTAAGCCTTTTGTGATCTTTACTGATCA
TGCGTCGTTACGCACTGCGACACAGTCGCCTCATCTCTCTCAGAGAATGGCAAGATGGCCTTCCTTCTTTGCCGAGTATAACTTCGAGGTGAGGTACAAG
CCGGGGCGGCTTAATGTAGTGGCCGATGCGCTCTCGCGCAGGCCGGACTACGAGTTAGCTCATGTCCCGACAGTGACGTCGTCAGTGCCTGACTTGATAC
GCGGAGCGTATGCACAAGACGACATGTGCGTAGCGCTGCTACGGGCTCTTGAGAGCGAAGGGTTTAAAGACTCTGATAAGGAATTGTCTGGGCGCTTACG
CGCGAGGCGGCATCGATACTCGCTCGATGGCGGTCTGCTGTACTACAGCACCGACTCTGAGGATAACCCTCGTGTAGTCGTTCCTCATGATGAGAATCTA
AAGTACTAATCCTCTATGAGGTTCATGATACGCCCGTGGGCGGGCACTTAGGTCGGGAGAAGACCTATGGCTCGGTGAGCTCGATGTACTGGTGGCCCAA
GATGTATAAGTGGGTTGGCACCTATGTACGCACGTGTGAGACGTGTCAACGGACGAAGTCCGCGCCGAGCACGGCAGCGCCATTGGCGAGTTTGCCTGTC
CCCAAGGGATGTTGGCAGTCCATGACTATGGACTTTGTGTTTGGCCTTCCCAAGGACAAGGCAGGAATCACGGGTATTGTGGTCTTTGTAGACCGATTGA
GCAAGATGGCTCATCTAGCGGCGGTGCCGGACACCATAGATGGTGAAGGTACAGCTTTGCTGTTTTTAGACCGAGTCTTTCGCCAACATGGCTTGCCTGA
GGCAATTGTCTCGGATCGAGACCCGCGCTTCACCGCGAAGTTCTGGACGTCCCTCTTCAGAGTGCTTGGCACTCGTTTGGACATGTCCACAGCGGACCAT
CCGCAGACCGATGGTCAAACAGAACGCGTGAATCGCGTTGTGGAGGATATCCTCCGAAGCGTATGCGCTTAGGCGCCAAAACGCTGGAGCCAGATGCTCC
CACTCGTCGAGTTCGCATTAAATAATGCAGTGCACGCCTCGACAGACTACACTCCGTTCTATGTGAACGGCTTGGTTAACCCTCGCGTCCCACTGACGCC
GCCACGCAGTGGCTCAGGGCTTGATGGGGGAGGGATAGCCGAGCGGCTAGCTGATGTCAGCCCTGTTGCGGTTCGCAAGCAAGCCAATGACTTTGTTTTT
TTGAGACTAAGCGTAATGCGTCAAGTACGCGACGCTATGGCTGAAAGCCAAGACATGCAAAAAGAACATGCAGATGCCAAAGGCAGACGCAATGAAGAAA
GGTTTGAGGTCGGAGACCAAGTTTTATTAAATACAAAAACCTACCTACTCATGCAGTGTCTGCAGTCTTTAAGACAAAATTGAGACCACGGTTCATAGGA
CCGTTCAAGGTCGTGGCCAAGAAGGGCCTAGCGTATACGCTTAACCTTCCGAAGAAGATGCGCACGCATCCAGTCTTCTACGTTGGCTTACTCAAGCCGT
ATCAGGACCCT