Description :
From Genome Similarity Track
Location :
Scaffold_85:85717- 90795
Transcript NameFunction/comments
Physo_140395reverse transcriptase

Sequence
5078 bases(100 bases per row)
TCCGCCAGCTGCCCGTTCCTCCGGGATGGCTCTTTCCGCTCTTGGTTCGTGGTGCCGTACAGCCTGTTGAAGGAACAGGCTATCGAGATGACTTGATCAC
CAGCCCCAACATCACGGCTCTGATGGCTGACCGCCCCTGGCAGGTCCTTCGAAACCCGGGAGGTCCTCTGACCTTCGATCTCGCATTACATCGGCGTAAC
GGCACTAGATTGGGTCGGATCGCGGACGCATACCTGCGATTCGAGGAGCGGAACCGGCAGGCTCTCTGGGAGGCCACTCATCACCTCCCGATCACTGGTA
CCCAGCGCGATGCCGACCCCGTCGGCGATCAGTACTATCAAGAGCGTCGAACACGGCGAATCCGTGTCGGTGATCGGTGGCGGCGACTCCTCCGCGATGT
ACTGCCAGTGATGCGTGATATGTGGGCGGACCTCGATCTGCTGCTTGATCCGTTCTTCCTACATATCCCTGTTCACCTGCGGGACTTTGGTACCTGGTAT
CCTGGCGTGGTATCCCGGGCCGCGAACGCCGGCGACCCCACCCAGCATCAATGTGAGCCGACCGACCTTCGGACAGCTCTGATCGAGGCAGACACCCACG
ATCCTTGGCGAAACCAGTACCGCTCAGGACCACCCAGCCCGGCAGATCCCTCGTCTTCGCAACAAGTTCAACCCCAATGTCGGCGCCCAGCAGCCGTAAT
ATCAGTCCAGCTCACACGGTCGGCTCCAGCGATCAGCCTGTCGGTTAGTCAGTTCACCCGAGGTCGTAGTCATTCGGAGGCCGATCCTCTTTAATCGTCG
CCCGACGTCTTCTGATCAATCCATCCCATTGCAATACTTCATTTTCTCTGCCGAGTGTCAACAGTCTTGGATCAATCCACTTATTCCAGCACGATCAGCT
AAGATCCACCATCATAACACCTTGCCATCGCTCCATAACCTTCCGATCTGCACTCTCATGCACACACTCATTCATATACAACCCCTTCCTCTGATCGACG
GCCTCCCCGTCGATCCGTCATCCATCTCGCTCACCAAGGCGACCAGCTCGCCCTGGCGGTCCGATCTCACTCTTCCTCGTGAGACCGCATCGCGCTGAAT
CGGTTCCGGTTCACGCGATCTCGAAGGAATTCGTACTATAGAGCTCCACAGTTGAGATCAGCCTCGTCAACCCAGTCAGGCTCGTCATAACCCTTCCAGT
GTACCAGGAACTCTCGATACGTCCGGCCATACCGAGTCCTGCGGCGTGTTCTCGTATCCGTGATCTTCTCCACTTCGTACTCGTTCGCGTCTCGATCTGG
GGCCCAGCTGTCCTCCGGAAGTAAGACTTCGTCAAAATCAAGTCGATCTGCTTCGTTCACCGTGAGCGCGATCTGCGGTCGATCGGGGAAGTCTCTGACC
AACTTCAGCTTCGACACATGCACGATCGGGAACAGGTGATAGTCTGTACCAGCGATCTGGAGCTTCATCGTGTACTCGTTCACCTTCTCCGCAACGCGGA
ACGGACCGTAGCCAGCTTCCGGGCATACCCCTCTTTCACACGATCCAGGTACAGCCACACCTGAGATCCAGCTTCGATCGAGTGCGGTCGAACTTCTTCA
TTGTGTCGATCGGCCCGATCCGTGATCGCCTCGCGTAGGCGAGCATTCACCTGACTTCGAGCCTGATCGTAGTGCCTCTGGATCCGATAACGCCACCGTC
GAGGATTCCGATCCCGAGTACTACCCAAAGGTATCGTCGCCTCGAGCGTCGATCGAGGATCCCAACCATGCACCAGATAAAAAGGGGAGTCTCCATGGAC
TCGATCTTGAGCCGTGTTGATCGCGAAGGTCAATCGCTCTGCGTACTCATCCCAATCACTCTGATCCAGATCCTCCACGAACATCTTCAGGGCTCTCGTC
GCCGTCTGTACCATTCGCTCTGCAGTACCGTTAGCTTGAGGTCGATATGCCATCGTCGCTCGCTGACGCATACCCAGGATCTTGTTAAAGGCGCGGATGA
AGTCGGCCATAAATCCCGGTTCGCGATCATGCCTGATCATCTCGCTAGCACCAAATCGCCGGAACACGCACTCTTCGTAAGACTCGGCGATCGTCTGCGC
CGTTCGGGACGAACTGGCCTTCGCGATCACGTATCCCGTGAACAGATCGGCCCAGATCAATAGTTCCGTATTACCCTTGTACGACTTCGGCAGCGAAGGT
ATGTGATCCATCGCTATGATCTGGAACGGGTATGTCGCCTGGATGTTCGCCGGCGACTTGCCCCTGATCGTGGGTCGTCCTTTGCCGGTCTCGCAGTCGA
TACATTCACCGACGTACTTCTGCACACTCCTGAAGAGACCTCTCCAGTGAAAATGATCGCGGATCCGCTGGTAGGTACGCCCGATCCCCTGGTGTCCACC
TTCCAGAGTGGAGTGATAGTGATGCAGAATATCTTGATGCAGCGTCTCCGGTGCCACCAGTCTCATCAGTCCATCACGATCTGCCTCCGATCGCTTGGAG
GGTGGGCAATAGAACAGCAGATTATCACCGTCGATCTCGTAGTCCGCTGCGAGGTTGCCATAGGATCGGGCCTCATCCTGTGTCAGATCTGCCACATCTC
TCCTCAGATACTTCTTCATACCCGCGATCCACGTTTCTTCATCATGTGCTCGACGAATCCGATCGATCCGCAACCCTCGCACGAACTCCTCCTGCATGAC
GGTCGGGTTCGGCCGTGATCGGGTGCCCGATCGGGTTGTCATCGGCGATAGTCGGGCGATCGAATCATCCGACCGGACGACCAGGATCTCGTCAAGTCGG
TTCAGTGTCACTAGATCCCCATGATCGGCATCCTCCTCGACGACGACGCCCCCTTCACGTTGGAGTGCTGCACTGGCCAGGCTGTCCGCACTTCCGTTCC
AGTCTCGTTTCACATGTAACAGCTCGTGATCTGGCCAGTTCCGTAGCTGATCCAGCAGCATCTGCTTCAACAATGTCAGCTTAGGTGCTTTGCGGTCAAT
CTCGCCCCGTACTTGTCGGATCACCAGGTTGGAGTCACCGCAGACCACTAACCTGACTCGATCTATGCCGTCAAGGAGGTCGAAACCCAACAACAGACCA
TGATACTCCGCCTCGTTAACAGTCAGCCCTTCAGCATAGCCCGATCGTGCCTTCACCACACTCCATACGGGTAACTTCCACAAGATCGCACTGTACGCAC
CCCCGCCTCGCTTGACGCGGGCAGATCCATCGAAACTTATCACCAGGTGCTCTTCGTCCGCACGTACAGTCGGGACCGGGGCCTGAATCTTCCGCCGGGG
TTCTTTCTTCGGCGCGATCGCGATCAACGCGTCGTCCATATCCGATCGAGGCGTAATACTAGCGGCGATCGCCCCCATTATCTTGTTCTCTCCTTTGGTG
CACTTCGTGATCTCCAGTGTCCAGGGCGATAGGAGTGCAGCCCACTGACCGAATCGGCCTTGAAGACCGGGAGATCGGAACAGCCACACCAACGTGGAGT
GTCGGGTCAAGACCCGGATCGATCGTCCAACCAGCATGTTATAGTTCAGGTCCAGGATCCGGAACAGCGCCAGCACTTCTTTCTCCACCACGTTGTAGTT
CAATTCATTCGACTTCAGCGTTCGACTGGCGAAGGTAACGGGATGATATATCTGGTCGTGCTCCTGCATCAATGCGGCCGAGATCGCCCAGTCACTCGCA
TACACAATCACGACCGGAGTCCGATCGCGATCGAAGTGCCGCAAGATCGGTGTCGTCGCGATCTTCATCTTCAGGGTCGAAAAGGCACGATGAGCACGGA
TCCAGCGTTCATCGGCTACACCGACTTCAGGAACTGATGGAGTTCGATCGGGGTTCACTGGGTCCGTATCCACTAAGTTCGGTACTTGATGATCCAGGAT
CTGGCGCATATCGGGGCGTTTCTTCAGCTCGGCGAAGTCCACCTCGTGCAGTTCGTACAGGATCACCGCGTAGATCGCGTAATCTTCCAAGAAACGGCTG
TAGTAGTTGAGACTTCCCAAGAATGACTGCACCGATCGGAGCGATCCGGGGAACGGCAGATCGGTCAGAGCCGTGAGATCCTTCGGATTGGCCTCCAGCC
CATCGTTCGACACACGATGTCCCAGATAGTCCACCTTACGCATCCCCCAAGAGCGCTTCTCCACGCTGATCGAGAGGTTCCACTTATCACAAGCGTCCAG
CAGGTGATCCGCGCGATCACACAGCTCGTCCCATGATCCGGCCGTCACAAGAATGTCATCAATGTACGATCTGCGACCTAGCACTGATAGACGCCCCGGA
TCTTCTGGTTCTCCTGACTCGATCAAGTCCGTAGTGACTTCACAGTCCGACGATCGCGGGATCCTGGTGAACCCATACAACGCGTCGTCGAGAAGTCGCT
GATAGATCTGAGGGGCGTTCTTCAGGCCGAACGGCATCCGGTTCCACTCGAACAGACCCATGTGGGTGATAAAGGCCGAGATCGCACGAGCTCGATCGGT
CATTGTCACCACCCAGAATCCGCTAGCCATGTCCAAAGAGCAATACCATAGTACCTTGTCCAGATCTTCCAGCAGATCGTTGATCAAGAGCATCGGATAT
ACCATCAGCCTGGTTAGACTGTTGACGAGCCGATAGTCGATACAGAGTCGGATATCCACGCCGTTCTTCTTGATGATCACGACGATCGGCGAGGCCCACG
GTGATCGAGATTTCCGAATCATCTTGGCTGACAGTAATCCCTTGATCAGCTCGGACACCTTCTCCACGAACTGAGGGGCAACTTTCCGGACGCGTTGAGC
GATCGGCTTCGCGTTGCCCACGTCGATGTCGCAGGTGACGCCCCGCTGGGGGAAGTGCATTGCCCTTGCCGATCAGCAGGTGATTCCTGTGCCAGATCTT
CTTTCGCAGCCGATCAATCTGCTCCGGGGTGTTGAACTCCAGATCTCCCACCTTGATATCATCAATCTTCACCTCATCCGTCGTCGAGATCACAATTTCA
GGGAGCACAGCTAATTCACCTTCGACATCTTCTGCTGACAGATTCCCGCCCTCGTGGTAATGAACCTGATCGTCAGCG